Aptamer-based bio-barcode assay for the detection of cytochrome-c released from apoptotic cells

An Assay Using Localized Surface Plasmon Resonance and Gold Nanorods Functionalized with Aptamers to Sense the Cytochrome-c Released from Apoptotic Cancer Cells for Anti-Cancer Drug Effect Determination

“…The sequence of the 76-mer cyto- c biotinylated-aptamer was 5′-biotin-TEG- ATCGATAAGCTTCCAGAGCC GTGTCTGGGGCCGACCGGCGCATTGGGTACGTTGTTGCCG TAGAATTCCTGCAGCC -3′, where the italics represent the constant region of our aptamer during the systematic evolution of ligands by exponential enrichment (SELEX) process in our previous reports [ 14 , 15 ]. Biotin-TEG, where the TEG (triethylene glycol) is the extended spacer arm of 15 atoms between aptamer and biotin to reduce hindrance of aptamer-target binding, was added at the 5′ region of the aptamer [ 14 ]. MMP Protein A magnetic beads, with a mean diameter of 2 μm, nonporous superparamagnetic microparticles (NEB S1425S) were obtained from New England BioLabs.…”

“…Previously, we have developed a number of aptamer-based bio-barcode (ABC) assays, in which a 76-mer DNA aptamer was employed to capture cyto- c selectively, and it also acts as both the recognition element and the bio-barcode reporter in the ABC assays [ 13 , 14 ]. This aptamer is a small single-chain DNA with a unique nucleotide sequence, which self-folds into a unique three-dimensional shape to bind cyto- c with high affinity and high specificity in a way similar to that in the antibody-antigen reactions.…”

DNA aptamers that target human glioblastoma multiforme cells overexpressing epidermal growth factor receptor variant III in vitro

“…The ability of aptamers to distinguish small differences in cell-surface antigens indicates the great potential of using the Cell-SELEX approach for the selection of new biomarkers to identify and isolate subpopulations of various cancer stem cells. In addition to specific target recognition [16,17] , aptamers can be designed to target a desired region or in a sequential manner to refine their functions [18,19] . They also possess several advantages over naturally occurring antibodies [20] , including the ease of synthesis, their stability under standard conditions, a lack of immunogenicity, rapid tissue penetration, and the ease of immobilization and modification on chemical devices.…”

Dynamic Bio‐Barcode Assay Enables Electrochemical Detection of a Cancer Biomarker in Undiluted Human Plasma: A Sample‐In‐Answer‐Out Approach

“…[14] Among these methods,b io-barcode assays that generate an ucleic acid barcode in response to protein recognition hold great promise for simplifying protein analysis. [15] In spite of this,the common employment of loaded nanoparticles (NPs) [16] or enzymes [17] for amplifying the nucleic acid reporter, makes single-step operation using these assays challenging.…”