Application of quantitative transcriptomics in evaluating the ex vivo effects of per- and polyfluoroalkyl substances on Atlantic cod (Gadus morhua) ovarian physiology

Khan, Essa Ahsan; Zhang, Xiaokang; Hanna, Eileen Marie; Yadetie, Fekadu; Jonassen, Inge; Goksøyr, Anders; Arukwe, Augustine

doi:10.1016/j.scitotenv.2020.142904

Cited by 18 publications

(17 citation statements)

References 75 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…found that PFOS was the active component in a mixture of PFOS, PFOA, and PFNA that altered normal ovarian function in Atlantic cod fish. 53 Neonatal exposure to high-dose PFOS or PFOA (0.1, 1, and

) reduced follicle numbers in female rats, although no altered ovarian morphology was observed. 54 Recent studies showed that PFOS 55 and PFNA 56 could impede oocyte maturation by damaging mitochondrial functions in vitro , inducing oxidative stress and causing apoptosis of oocytes.…”

Section: Discussionmentioning

confidence: 93%

Perfluoroalkyl Acids in Follicular Fluid and Embryo Quality during IVF: A Prospective IVF Cohort in China

Zeng

Bloom

Wei

et al. 2023

Environ Health Perspect

View full text Add to dashboard Cite

Background: Perfluoroalkyl acids (PFAA) have been measured in ovarian follicular fluid from women using in vitro fertilization (IVF), although associations between follicular fluid PFAA and IVF outcomes have been inconsistent. Objectives: We investigated the association between follicular fluid PFAA and embryo quality in women undergoing IVF. Methods: We prospectively enrolled 729 women undergoing IVF treatment in Guangxi province, China, from July 2018 to December 2018. We measured 32 PFAA, including branched isomers, in follicular fluid using ultra-performance liquid chromatography coupled to tandem mass spectrometry. We applied restricted cubic splines, linear regression, and log-binominal regression models to investigate associations between follicular fluid PFAA and embryo quality, adjusting for confounding variables and investigated oocyte maturity as an intervening variable using causal mediation analysis. We further estimated the overall effect of the PFAA mixture on outcomes using Bayesian kernel machine regression (BKMR). Results: We detected 8 of 32 measured PFAA in of follicular fluid samples. Higher PFAA concentrations were associated with fewer high-quality embryos from IVF. The high-quality embryo rates at the 50th percentile of linear perfluoro-1-octanesulfonate acid (n-PFOS), all branched PFOS isomers (Br-PFOS) and linear perfluoro- -octanoic acid (n-PFOA) were [95% confidence interval (CI): , ], (95% CI: , ) and (95% CI: , ) lower, respectively, than the high quality embryo rates at the reference 10th percentile of PFAA. Oocyte maturity mediated 11.76% (95% CI: 3.18, 31.80%) and 14.28% (95% CI: 2.95, 31.27%) of the n-PFOS and n-PFOA associations, respectively. The results of the BKMR models showed a negative association between the PFAA mixture and the probability of high-quality embryos, with branched PFOS isomers having posterior inclusion probabilities of 1 and accounting for the majority of the association. Discussion: Exposure to higher PFAA concentrations in follicular fluid was associated with poorer embryo quality during IVF. Branched PFOS isomers may have a stronger effect than linear PFOS isomers. More studies are needed to confirm these findings and to directly estimate the effects on pregnancy and live-birth outcomes. https://doi.org/10.1289/EHP10857

show abstract

Section: Discussionmentioning

confidence: 93%

Perfluoroalkyl Acids in Follicular Fluid and Embryo Quality during IVF: A Prospective IVF Cohort in China

Zeng

Bloom

Wei

et al. 2023

Environ Health Perspect

View full text Add to dashboard Cite

show abstract

“…Complementary DNA (cDNA) was synthesized from 1 μg total RNA using the iScript cDNA synthesis kit in accordance with the included protocol (Bio-Rad, Oslo, Norway). RNA isolation, cDNA synthesis, and real-time PCR analysis was performed based on the standard protocol and as described previously. , The following primer pairs were used for lumpfish cyp1a (accession number: XM_034540817): Forward primer: GATGTACTTGGTGGCTTACC. Reverse primer: GAAGGAGCTCAAGGATGAAG (product size of 143 bp).…”

Section: Methodsmentioning

confidence: 99%

“…RNA isolation, cDNA synthesis, and real-time PCR analysis was performed based on the standard protocol and as described previously. 28,29 The following primer pairs were used for lumpfish cyp1a (accession number: X M _ 0 3 4 5 4 0 8 1 7 ) : F o r w a r d p r i m e r : G A T G -TACTTGGTGGCTTACC. Reverse primer: GAAGGAGCT-CAAGGATGAAG (product size of 143 bp).…”

Section: ■ Experimental Sectionmentioning

confidence: 99%

Effects of Exposure Timing on cyp1a Expression, PAH Elimination, and Lipid Utilization in Lumpfish Embryos Exposed to Produced Water

Hansen,

Arukwe,

Knutsen

et al. 2023

Environ. Sci. Technol.

Self Cite

View full text Add to dashboard Cite

Intentional discharges of produced water from oil production platforms to the marine environment contain a complex mixture of toxicants, including polycyclic aromatic hydrocarbons (PAHs). Early life stages of fish are highly sensitive to petrogenic exposure, and short-term exposure during critical periods of embryonic development may have detrimental effects on larvae health and survival. However, why different periods are more sensitive to exposure than others are not fully understood. Three identical exposure experiments (48 h, approx. 30 μg/L tPAH, sum 42 PAHs) on lumpfish (Cyclopterus lumpus) embryos were conducted where only exposure timing was varied: 0–48 h post fertilization (hpf, starting before chorion hardening), 36–84 hpf (starting after chorion hardening), and 240–288 hpf (during organogenesis). Total PAH (tPAH) uptake at the end of exposure was 5× higher when exposed during fertilization than when exposed late (during organogenesis). The first evidence of cyp1a induction in lumpfish during embryogenesis was observed after 84 hpf. Early exposure affected lipid droplet coagulation, indicating altered lipid utilization during embryogenesis. Although no significant impacts of exposure were observed on hatching success, hatching was delayed when exposed at the latest time point. This study shows that chorion properties, lipid content, biotransformation potential, and timing of produced water exposure during lumpfish embryogenesis affected PAH uptake and elimination.

show abstract

“…We conducted an extensive literature search across databases to identify transcriptomics studies focusing on the effects of PFAS on animal samples. A total of 11 transcriptomics datasets were identified, containing publicly available data from 7 different species (Homo sapiens, Mus musculus, Caenorhabditis elegans, Danio rerio, Gadus morhua, Micropterus salmoides, Pimephales promelas) (Table 1) [38][39][40][41][43][44][45][46][47][48][49]. Data associated with these studies were retrieved from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/) [50] and the Sequence Read Archive (SRA) database (https://www.ncbi.nlm.nih.gov/sra) [51], both hosted at the National Center for Biotechnology Information (NCBI).…”

Section: Data Collection and Processingmentioning

confidence: 99%

Cross-species Transcriptomics Analysis Highlights Conserved Molecular Responses to Per- and Polyfluoroalkyl Substances (PFAS)

Beccacece¹,

Costa²,

Pascali³

et al. 2023

Preprint

View full text Add to dashboard Cite

In the recent decades, per- and polyfluoroalkyl substances (PFAS) have garnered widespread public attention due to their persistence in the environment and detrimental effects on the health of living organisms, spurring the generation of several transcriptome-centered investigations to understand the biological basis of their mechanism. In this study, we analyzed 2144 publicly available datasets from 7 distinct species to examine the molecular responses to PFAS exposure and determine if there are conserved responses. Our comparative transcriptional analysis revealed that exposure to PFAS is conserved across different tissues, molecules and species. We identified and reported several genes exhibiting consistent and evolutionarily conserved transcriptional re-sponse to PFAS, such as ESR1, HADHA and ID1, as well as several pathways including lipid me-tabolism, immune response and hormone pathways. This study provides the first evidence that distinct PFAS molecules induce comparable transcriptional changes and affect the same metabolic processes across inter-species borders. Our findings have significant implications for under-standing the impact of PFAS exposure on living organisms and the environment. We believe that this study offers a novel perspective on the molecular responses to PFAS exposure and provides a foundation for future research into developing strategies for mitigating the detrimental effects of these substances.

show abstract

Application of quantitative transcriptomics in evaluating the ex vivo effects of per- and polyfluoroalkyl substances on Atlantic cod (Gadus morhua) ovarian physiology

Cited by 18 publications

References 75 publications

Perfluoroalkyl Acids in Follicular Fluid and Embryo Quality during IVF: A Prospective IVF Cohort in China

Perfluoroalkyl Acids in Follicular Fluid and Embryo Quality during IVF: A Prospective IVF Cohort in China

Effects of Exposure Timing on cyp1a Expression, PAH Elimination, and Lipid Utilization in Lumpfish Embryos Exposed to Produced Water

Cross-species Transcriptomics Analysis Highlights Conserved Molecular Responses to Per- and Polyfluoroalkyl Substances (PFAS)

Contact Info

Product

Resources

About