Application of fluorescence in situ hybridization technique to detect simazine-degrading bacteria in soil samples

Martín, Margarita; Gibello, Alicia; Lobo, Carmen; Nande, Mar; Garbi, Carlos; Fajardo, Carmen; Caracciolo, Anna Barra; Grenni, Paola; Martinez-Inigo, M.J.

doi:10.1016/j.chemosphere.2007.10.071

Cited by 26 publications

(7 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The detection of s-triazines, together with the high nitrate concentration, demonstrates that this groundwater represents a contaminated ecosystem. Moreover, the bacterial abundance and the high percentage of cell viability, similar to or greater than that found in some surface soils studied (Martin et al, 2008;Grenni et al, 2009a), indicated the presence of a natural microbial community quite active in this aquifer. Figure 1 shows the terbuthylazine concentration as a percentage of original concentration vs. time (days) under the two different experimental conditions (TBA and sterile).…”

Section: Resultssupporting

confidence: 67%

“…Before filtering, isolated bacteria were incubated with lysozyme (12 mg mL −1 ) for 20 min at 37 °C to permeabilize the cells. Filters with cells fixed as described previously were analysed by FISH using the specific probe 5′FAM‐AtzB1 (5′‐GGAGAGCACCGATACTTTTCTT‐3′), under the conditions described previously (Martin et al , 2008). Percentages of atz B‐harbouring cells were calculated based on the total number of cells stained with DAPI.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

The role of a groundwater bacterial community in the degradation ofâ the herbicide terbuthylazine

Caracciolo

Fajardo

Grenni

et al. 2010

FEMS Microbiology Ecology

Self Cite

View full text Add to dashboard Cite

A bacterial community in an aquifer contaminated by s-triazines was studied. Groundwater microcosms were treated with terbuthylazine at a concentration of 100 microg L(-1) and degradation of the herbicide was assessed. The bacterial community structure (abundance and phylogenetic composition) and function (carbon production and cell viability) were analysed. The bacterial community was able to degrade the terbuthylazine; in particular, Betaproteobacteria were involved in the herbicide biotransformation. Identification of some bacterial isolates by PCR amplification of the 16S rRNA gene revealed the presence of two Betaproteobacteria species able to degrade the herbicide: Advenella incenata and Janthinobacterium lividum. PCR detection of the genes encoding s-triazine-degrading enzymes indicated the presence of the atzA and atzB genes in A. incenata and the atzB and atzC genes in J. lividum. The nucleotide sequences of the PCR fragments of the atz genes from these strains were 100% identical to the homologous genes of the Pseudomonas sp. strain ADP. In conclusion, the results show the potential for the use of a natural attenuation strategy in the treatment of aquifers polluted with the terbuthylazine. The two bacteria isolated could facilitate the implementation of effective bioremediation protocols, especially in the case of the significant amounts of herbicide that can be found in groundwater as a result of accidental spills.

show abstract

Section: Resultssupporting

confidence: 67%

Section: Methodsmentioning

confidence: 99%

The role of a groundwater bacterial community in the degradation ofâ the herbicide terbuthylazine

Caracciolo

Fajardo

Grenni

et al. 2010

FEMS Microbiology Ecology

Self Cite

View full text Add to dashboard Cite

show abstract

“…The high share of the genus Pseudomonas spp. in the structure of bacterioplankton in the lake located within the area re-cultivated after the pesticide tomb may be confirmed by periodical inflows (Table 2) or the recent presence in the lake waters of complex chemical substances which have been specifically decomposed by the microbes sought (Lopez et al 2002;Beulke et al 2005;Martín et al 2008).…”

Section: Discussionmentioning

confidence: 90%

“…It has been proven that one of the most frequently isolated strains which can cause pesticide degradation in a wide range is genus Pseudomonas (Abou-Arab 2002; Lopez et al 2005;Martín et al 2008). Kamanavalli and Ninnekar (2000) showed that Pseudomonas can cause pesticide degradation, and can use them as a source of carbon and nitrogen.…”

Section: Discussionmentioning

confidence: 98%

Seasonal patterns of the bacterioplankton community composition in a lake threatened by a pesticide disposal site

Lew¹,

Lew²,

Szarek³

et al. 2010

Environ Sci Pollut Res

View full text Add to dashboard Cite

The study showed that the qualitative and quantitative changes in the bacterioplankton of the lake can be characterised by tendencies which are typical of a eutrophic water reservoir. However, a higher contribution of microorganisms capable of degrading sparingly degradable, toxic compounds and pesticides was determined in bacterioplankton from the PD-contaminated lake, as compared to microbial communities of a lake not contaminated with pesticides.

show abstract

“…However, the detection is often affected by strong autofl uorescence of the background especially in soil samples. A number of variations to this tool are reported in literature [41,42]. Catabolic potential of the microbial community has also been reported using isotope tracer methods.…”

Section: Isotope-labeled Assaysmentioning

confidence: 99%

Genomic tools in bioremediation

Kapley

Purohit

2009

Indian J Microbiol

View full text Add to dashboard Cite

Bioremediation is a process that uses microorganisms or their enzymes to remove pollutants from the environment. Generally, bioremediation technologies can be classifi ed as in situ or ex situ. In situ bioremediation involves treating the contaminated material at the site while ex situ involves the removal of the contaminated material to be treated elsewhere. Like so much else in biology, the ease and availability of genomic data has created a new level of understanding this system. Bioremediation capabilities of the microbial population can be analyzed; not only by physiological parameters, but also by the use of genomic tools, and effi cient remediation strategies can be planned. PCR and DNA-or oligonucleotide-based microarray technology is a powerful functional genomics tool that allows researchers to view the physiology of a living cell from a comprehensive and dynamic molecular perspective. This paper explores the use of such tools in bioremediation process.

show abstract

Application of fluorescence in situ hybridization technique to detect simazine-degrading bacteria in soil samples

Cited by 26 publications

References 30 publications

The role of a groundwater bacterial community in the degradation ofâ the herbicide terbuthylazine

The role of a groundwater bacterial community in the degradation ofâ the herbicide terbuthylazine

Seasonal patterns of the bacterioplankton community composition in a lake threatened by a pesticide disposal site

Genomic tools in bioremediation

Contact Info

Product

Resources

About

Application of fluorescence in situ hybridization technique to detect simazine-degrading bacteria in soil samples

Cited by 26 publications

References 30 publications

The role of a groundwater bacterial community in the degradation ofâ the herbicide terbuthylazine

The role of a groundwater bacterial community in the degradation ofâ the herbicide terbuthylazine

Seasonal patterns of the bacterioplankton community composition in a lake threatened by a pesticide disposal site

Genomic tools in bioremediation

Contact Info

Product

Resources

About

The role of a groundwater bacterial community in the degradation ofâ the herbicide terbuthylazine

The role of a groundwater bacterial community in the degradation ofâ the herbicide terbuthylazine