Application of a new PCR primer for terminal restriction fragment length polymorphism analysis of the bacterial communities in plant roots

Sakai, Masao; Matsuka, Akira; Komura, Taichi; Kanazawa, Susumu

doi:10.1016/j.mimet.2004.06.005

Cited by 62 publications

(55 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…DNA from 100 mg of lyophilized PN was extracted with a QIAamp DNA Stool Mini Kit (Qiagen, Hilden, Germany) and used as the template for 16S rRNA gene amplification. To identify the bacteria in the algal suspension, degenerate prim-doi: 10.17221/8522-CJAS ers 16Seu27f (5' AGAGTTTGATCMTGGCKCAG) (Lane 1991) and 16Seu783r (an equimolar mix of 5'CTACCAGGGTATCTAATCCTG, 5'CTAC-CGGGGTATCTAATCCCG, and 5'CTACCCGGG-TATCTAATCCGG) (Sakai et al 2004) were used. The PCR mixture contained 50 ng DNA, 0.25mM of each primer, 50mM of each dNTP, and 1 U LA polymerase (Top-Bio, Prague, Czech Republic) in a total volume of 50 ml.…”

Section: Methodsmentioning

confidence: 99%

Effect of green alga Planktochlorella nurekis on selected bacteria revealed antibacterial activity in vitro

Čermák¹,

Pražáková²,

Marounek³

et al. 2015

CZECH J ANIM SCI

View full text Add to dashboard Cite

ABSTRACT:The green alga Planktochlorella nurekis (Chlorellaceae, Chlorophyta) is considered a producer of antibacterial mixture of long-chain fatty acids, which has possibly similar composition and mode of action as chlorellin produced by another green alga, Chlorella vulgaris. Although the antibacterial properties of C. vulgaris have been reported, the interactions of P. nurekis with bacteria have not been determined yet. The aim of this study was to elucidate the effect of P. nurekis water suspension on growth of selected gastrointestinal bacteria in vitro so that it could be used as a suitable feed supplement in animal farming. Unknown bacterial populations occurring in the algal suspension were identified using 16S rRNA sequencing assay. Selected strains were cultivated with lyophilized P. nurekis and the antibacterial effect was monitored. The composition of fatty acids and heat sensitivity of antibacterial substances were also examined. Sequencing analysis of 71 bacterial 16S rRNA genes in xenic algal suspension identified common environmental microbiota, one strain belonging to the class Alphaproteobacteria, 17 to Betaproteobacteria, 44 to Gammaproteobacteria (dominated by Pseudomonas putida strains), and nine to Sphingobacteria. The antimicrobial activity of P. nurekis suspension was tested at a concentration range of 0.75-6 mg/ml. The highest inhibitory effect was observed on bifidobacteria. Statistically significant reductions in bacterial counts were also observed for Escherichia coli, Salmonella enterica var. Enteritidis, S. enterica var. Infantis, Campylobacter jejuni, and Arcobacter butzleri. The growth of Lactobacillus johnsonii was significantly stimulated. The relative proportions of C14-C22 fatty acids in P. nurekis were found as follows: saturated 54.28%, monounsaturated 30.40%, and polyunsaturated 7.16%. The antibacterial compounds present in P. nurekis suspension exhibited thermostability. The results indicate that P. nurekis can inhibit some pathogenic gastrointestinal bacteria and seems to be a promising essential nutrients source in animal nutrition.

show abstract

Section: Methodsmentioning

confidence: 99%

Effect of green alga Planktochlorella nurekis on selected bacteria revealed antibacterial activity in vitro

Čermák¹,

Pražáková²,

Marounek³

et al. 2015

CZECH J ANIM SCI

View full text Add to dashboard Cite

show abstract

“…To test the purity of DNA extracted by the tested methods, PCRs were conducted for all samples with universal eubacterial primers for the 16S rRNA gene. A PCR was performed in 50 l total volume, according to the following protocol: 50 to 100 ng of DNA, 1ϫ Taq (24). A PCR was performed once for each DNA extraction; so, three PCRs were performed for each soil sample.…”

Section: Methodsmentioning

confidence: 99%

Innovative Methods for Soil DNA Purification Tested in Soils with Widely Differing Characteristics

Sagova‐Mareckova

Čermák

Novotná

et al. 2008

Appl Environ Microbiol

214

113

View full text Add to dashboard Cite

). This study demonstrated significant differences between the tested methods in terms of DNA yield, PCR performance, and recovered bacterial diversity. The differences in DNA yields were correlated to vegetation cover, soil pH, and clay content. The differences in PCR performances were correlated to vegetation cover and soil pH. The innovative methods improved PCR performance in our set of soils, in particular for forest acidic soils. PCR was successful in 95% of cases by the method using CaCl 2 purification and in 93% of cases by the method based on CaCO 3 pretreatment, but only in 79% by Mo Bio PowerSoil, for our range of soils. Also, the innovative methods recovered a higher percentage of actinomycete diversity from a subset of three soils. Recommendations include the assessment of soil characteristics prior to selecting the optimal protocol for soil DNA extraction and purification.

show abstract

“…Primers used for amplification of bacterial 16S rRNA genes for T-RFLP were: forward 16Seu 27f (5'-AGAGTTTGATCMTGGCKCAG) [25]; modified [26] labelled with HEX on the 5' end, and reverse 783r (equimolar mix of 5'CTACCVGGGTATCTAATCCBG) [27]. For cloning, a non-labelled 27f forward primer combined with PH reverse primer (AAGGAGGTGATCCAGCCGCA); [28] for bacteria and act1114r (GAGTTGACCCCGGCRGT); [29] for actinobacteria were used.…”

Section: Terminal Restriction Fragment Length Polymorphism Analysis Amentioning

confidence: 99%

Bacterial diversity and abundance of a creek valley sites reflected soil pH and season

et al. 2015

View full text Add to dashboard Cite

The effect of environmental factors on bacterial and actinobacterial communities was assessed to predict microbial community structure in natural gradients. Bacterial and actinobacterial communities were studied at four sites differing in vegetation and water regime: creek sediment, wet meadow, dry meadow and deciduous forest located in a shallow valley. The vegetation structure was assessed by phytocoenological releves. T-RFLP and quantitative PCR were used to determine community composition and abundances. Significant relationships between bacterial community structure and selected soil traits at sites located relatively close to each other (within 200 m) were demonstrated. Both the quantity and structure of bacterial communities were significantly influenced by organic matter content, soil moisture and pH. Bacterial diversity was higher in summer, while that of actinobacteria increased in winter. The Simpson’s evenness E was significantly correlated with soil organic matter content. Soil pH had the greatest influence on bacterial community structure showing higher within-site variability in summer than in winter.

show abstract

Application of a new PCR primer for terminal restriction fragment length polymorphism analysis of the bacterial communities in plant roots

Cited by 62 publications

References 15 publications

Effect of green alga Planktochlorella nurekis on selected bacteria revealed antibacterial activity in vitro

Effect of green alga Planktochlorella nurekis on selected bacteria revealed antibacterial activity in vitro

Innovative Methods for Soil DNA Purification Tested in Soils with Widely Differing Characteristics

Bacterial diversity and abundance of a creek valley sites reflected soil pH and season

Contact Info

Product

Resources

About