Apoptotic activity of doxazosin on prostate stroma in vitro is mediated through an autocrine expression of TGF‐β1

Ilio, Kenneth Y.; Park, Irwin I.; Pins, Michael; Kozlowski, James M.; Lee, Chung

doi:10.1002/pros.1091

Cited by 32 publications

(28 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…However, the action of quinazoline-derived 1-ADR antagonists on the human hyperplastic prostate has been reported to be proapoptotic without affecting cell proliferation, 16 and the apoptotic effect has been attributed to enhanced TGF-ß1 expression. 19,20 Data opposing the activation of the TGF-ß transduction pathway being responsible for quinazoline-derived 1-ADR antagonists-induced apoptosis have been published recently. 44 Instead, molecular targets consistent with tumour necrosis factor (TNF)--related activity were identified.…”

Section: Discussionmentioning

confidence: 99%

“…13 Prostatic cell apoptosis has been identified as an additional mechanism of long term action for doxazosin and terazosin, [14][15][16][17] while it has been postulated that the apoptotic effect is probably quinazoline nucleus directed rather than 1-ADR mediated. 18 The apoptotic effect of 1-ADR antagonists has been attributed to transforming growth factor ß1 (TGF-ß1) since in vitro treatment of primary human prostate cell cultures with doxazosin 19 , as well as in vivo treatment with terazosin 20 , resulted in enhanced TGF-ß1 expression. This results in upregulation of p27 kip-1 , a downstream intracellular effector of TGF-ß1 apoptotic signaling 21 and, possibly, activation of the caspase cascade.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Terazosin treatment suppresses basic fibroblast growth factor expression in the rat ventral prostate

Mitropoulos

Kyroudi-Voulgari²,

Christelli³

et al. 2009

CIM

View full text Add to dashboard Cite

Purpose: Alpha1-adrenergic receptor antagonists may not act solely on smooth muscle contractility. We evaluated the in vivo effect of the alpha1 blocker, terazosin, on the expression of basic fibroblast growth factor (bFGF) in the rat ventral prostate. Methods: Wistar rats were treated with terazosin (1.2 mg/ kg body weight, po, every second day) for 120 days. The expression of bFGF was assessed immuno-histochemically in tissue sections and by Western blotting in whole tissue preparations. Results: Terazosin treatment did not affect prostate weight or histomorphology. In the control group, epithelial and stromal cells demonstrated positive staining for the antibFGF antibody. In contrast, the same staining in terazosintreated specimens was either absent or extremely weak. An analogous difference was observed among the corresponding immunoblots. Conclusions: These findings implicate the reduction of bFGF expression by terazosin as a potential additional molecular mechanism of its action that may include alterations in peptide growth factor mediated prostate homeostasis.Drugs that block the action of sympathetic neurotransmitters on 1-adrenergic receptors ( 1-ADRs) are widely used for the treatment of patients with benign prostate hyperplasia (BPH)-related lower urinary tract symptoms. The rationale for their use stems is that they effectively relax prostate smooth muscles, 1 which represent approximately 40% of the cellular volume in hyperplastic glands. 2 The biological effects of extrinsic factors such as hormones and other endocrine-related agents on the prostate are mediated by various peptide growth factors produced by the gland and influence prostate growth, differentiation and function by promoting inter-and intracellular signaling between and within cell populations, through paracrine, autocrine and intracrine effects. 3 Data from several studies indicate that 1-ADR antagonists may not act solely on smooth muscle contractility. Intact autonomic innervation of the rat ventral prostate is necessary to maintain its structural and functional integrity. [4][5][6] Administration of the sympathomimetic phenylephrine induces ventral prostate hyperplasia associated with reduced rates of cellular apoptosis, but not with increased rates of cellular proliferation. 7 Moreover, rapid proliferation of prostatic epithelial cells has been seen in the spontaneously hypertensive rat, 8 an animal model with in-ORIGINAL RESEARCH

show abstract

Section: Discussionmentioning

confidence: 99%

mentioning

confidence: 99%

Terazosin treatment suppresses basic fibroblast growth factor expression in the rat ventral prostate

Mitropoulos

Kyroudi-Voulgari²,

Christelli³

et al. 2009

CIM

View full text Add to dashboard Cite

show abstract

“…[32] An independent report implicated expression of TGF-β1 as a possible means of apoptosis induction in primary cultures of prostate cancer cells, showing that doxazosin-treated cells undergoing apoptosis produced more TGF-β1 than untreated cells, an effect that was reversed by a neutralizing TGF-β1 antibody. [33] Further support for the functional involvement of TGF-β signaling in quinazoline-mediated apoptotic action against prostate cancer cells, stems from a recent study by Xu et al [34], demonstrating that terazosin-induced apoptosis in human prostate cancer cells, PC-3 and DU-145, is associated with p27 Kip1 upregulation (a cycle dependent kinase inhibitor and an intracellular effector of TGF-β apoptotic signaling) and proceeds via an Rb and p53 independent pathway. Moreover, a new mechanistic insight has recently been gained from a structural dissection studies of the effect, demonstrating that the apoptosis-inducing property of doxazosin in androgen-independent prostate cancer cells proceeds by targeting the intracellular Akt activation survival pathway.…”

Section: Apoptosis Induction By Quinazolines: Targeting Survival Indementioning

confidence: 99%

The role of α-blockers in the management of prostate cancer

Tahmatzopoulos

Rowland

Kyprianou

2004

Expert Opinion on Pharmacotherapy

View full text Add to dashboard Cite

Prostate cancer is the second most common cause of cancer death in men in the United States. Patients with prostate cancer are initially treated with surgical resection, radiation or antiandrogen therapy. After an initial remission however, the majority of prostate tumors evolve into a highly aggressive, metastatic androgen-independent state for which successful therapy has not yet been established. During recent years, new perspectives have emerged towards the development of preventive and therapeutic approaches for prostate cancer. The quinazoline-based α 1 -blockers have been shown to have antitumor efficacy against prostate cancer cells via their potency to induce apoptosis and anoikis via an α 1 -adrenoceptor-independent mechanism. Specifically, doxazosin and terazosin can induce apoptosis, inhibit invasion and migration of prostate cancer cells and endothelial cells and reduce their adhesion potential to extracellular matrix components (ECM), thus enhancing their susceptibility to anoikis. In this review we discuss recent evidence suggesting the apoptotic efficacy of quinazoline-based α 1 adrenoceptor antagonists, doxazosin and terazosin and we speculate on the therapeutic promise of these drugs as novel antitumor agents against prostate cancer. From a drug discovery perspective, separation of the effect of doxazosin on apoptosis in prostate cancer cells from its original pharmacological activity in normal prostate cells, will provide a molecular basis to develop a novel class of apoptosis-inducing agents through lead optimization.

show abstract

“…For p22 phox mRNA expression, PCR was performed using specifi c primers designed with the aid of the Primer3 software as previously reported [14] , and their sequence is: 5 -3 : TGGGCG-GCTGCTTGATGGT (nucleotide sequence position 169-188) and GTTTGTGTGCCTGCTGGAGT (465-485). The conditions of amplifi cation were: 95 ° C for 1 min, 60 ° C for 1 min, 72 ° C for 1 min, for 30 cycles of amplifi cation as previously reported [21] .…”

Section: Molecular Biology Assaymentioning

confidence: 99%

“…Doxazosin, when used in BPH, prevents prostate smooth muscle cell contraction, which is a major cause of lower urinary tract symptoms. In addition to its effects on the symptoms of BPH, doxazosin has been shown to induce prostate epithelial and stromal cell apoptosis through autocrine production of transforming growth factor-␤ (TGF-␤ ) and induction of TGF-␤ signaling in in vitro experiments [13][14][15] . However, the mechanisms responsible for these effects are only partially characterized.…”

Section: Introductionmentioning

confidence: 99%

Effect of Doxazosin on Oxidative Stress-Related Proteins in Benign Prostatic Hyperplasia

Calò¹,

Pagnin²,

Davis³

et al. 2006

Urol Int

View full text Add to dashboard Cite

Background and Objectives: Oxidative stress can induce cell mutations or proliferation which then can progress to carcinogenesis or remodeling. The same oxidative stress-mediated mechanism could participate in prostate cell proliferation and remodeling present in benign prostatic hyperplasia (BPH). Doxazosin induces prostate epithelial and stromal cell apoptosis through production of transforming growth factor-β (TGF-β), but cellular mechanisms are not completely clarified. In 10 prostate samples from BPH untreated patients who underwent TUR, we have assessed the gene and protein expression of: p22^phox (subunit of NAD(P)H oxidase essential for O₂^– production); heme oxygenase-1 (HO-1) (induced by oxidative stress and antiapoptotic); TGF-β (inhibitor of prostatic epithelial and stromal cell growth); the in vitro effect of doxazosin on expression of these markers. Methods: RT-PCR and Western blot with specific primers and antibodies. p22^phox, HO-1 and TGF-β were quantified by the ratio between their PCR and Western blot products and GAPDH. Results: Doxazosin significantly reduced p22^phox gene and protein expression (0.61 ± 0.04 vs. 0.36 ± 0.04 d.u., p < 0.0002; 0.85 ± 0.03 vs. 0.47 ± 0.03, p < 0.0001, respectively). Doxazosin concentration dependently reduced HO-1 gene and protein expression (0.57 ± 0.07 vs. 0.49 ± 0.06 d.u. (1 µM) p < 0.04, vs. 0.22 ± 0.08 (10 µM) p < 0.0001; 0.78 ± 0.04 vs. 0.44 ± 0.1 (10 µM) p < 0.003 respectively) and increased TGF-β protein expression (0.58 ± 0.05 vs. 0.74 ± 0.16 (1 µM) n.s. vs. 0.81 ± 0.07 (10 µM) p < 0.01). Conclusions: Induction of oxidative stress-related proteins seems to be involved in the prostate cell proliferation and remodeling present in BPH. Doxazosin may reduce oxidative stress through reduction of p22^phox. Surprisingly, HO-1, which is induced and protected by oxidative stress, is also reduced by doxazosin. HO-1 is a potent antiapoptotic factor and downregulator of TGF-β. From the results of this preliminary study it could be proposed that the proapoptotic effect of doxazosin could be mediated, at least in part, through the contemporary inhibition of HO-1.

show abstract

Apoptotic activity of doxazosin on prostate stroma in vitro is mediated through an autocrine expression of TGF‐β1

Abstract: These results demonstrate that the apoptotic effect of Doxazosin on human prostatic stromal cells is mediated through an autocrine production of TGF-beta1.

Cited by 32 publications

References 19 publications

Terazosin treatment suppresses basic fibroblast growth factor expression in the rat ventral prostate

Terazosin treatment suppresses basic fibroblast growth factor expression in the rat ventral prostate

The role of α-blockers in the management of prostate cancer

Effect of Doxazosin on Oxidative Stress-Related Proteins in Benign Prostatic Hyperplasia

Contact Info

Product

Resources

About