APOBEC-mediated interference with hepadnavirus production

Abstract

APOBEC3G is a cellular cytidine deaminase displaying broad antiretroviral activity. Recently, it was shown that APOBEC3G can also suppress hepatitis B virus (HBV) production in human hepatoma cells. In the present study, we characterized the mechanisms of APO-BEC-mediated antiviral activity against HBV and related hepadnaviruses. We show that human APOBEC3G blocks HBV production in mammalian and nonmammalian cells and is active against duck HBV as well. Early steps of viral morphogenesis, including RNA and protein synthesis, binding of pregenomic RNA to core protein, and self-assembly of viral core protein, were unaffected. However, APOBEC3G rendered HBV core protein-associated full-length pregenomic RNA nuclease-sensitive. Ongoing reverse-transcription in capsids that had escaped the block in morphogenesis was not significantly inhibited. The antiviral effect was not modulated by abrogating or enhancing expression of the accessory HBV X protein, suggesting that HBV X protein does not represent a functional homologue to the HIV vif protein. Furthermore, human APOBEC3F but not rat APOBEC1 inhibited HBV DNA production. Viral RNA and low-level DNA produced in the presence of APOBEC3F or rat APOBEC1 occasionally displayed mutations, but the majority of clones were wild-type. In conclusion, APOBEC3G and APOBEC3F but not rat APOBEC1 can downregulate the production of replication-competent hepadnaviral nucleocapsids. In contrast to HIV and other retroviruses, however, APOBEC3G/3F-mediated editing of nucleic acids does not seem to represent an effective innate defense mechanism for hepadnaviruses. H epadnaviruses are a group of small enveloped DNA viruses with a narrow host range and a relative tropism for the liver. Hepatitis B virus (HBV), the prototypic member of the hepadnavirus family, is a major cause of liver disease worldwide, ranging from acute and chronic hepatitis to cirrhosis and hepatocellular carcinoma. 1,2 Other members of the family include the duck hepatitis B virus (DHBV) and the woodchuck hepatitis virus. 3,4 Hepadnaviral replication involves reverse-transcription of a pregenomic RNA (pgRNA) intermediate inside nucleocapsids, which are formed by 180 or 240 core protein subunits. Inside the capsid, the viral polymerase converts pgRNA into minus-strand DNA, which in turn is completed to a double-stranded, relaxed circular DNA molecule. 5,6 This life cycle places HBV into the large family of retroelements, which all require reverse-transcription of an RNA intermediate.Recently, a cellular defense mechanism targeting a wide range of retroviruses was identified. It was shown that the propagation of HIV-1 strains lacking the accessory protein Vif is suppressed in a number of nonpermissive cells and that this block was due to expression of the cytidine deaminase APOBEC3G (A3G). 7,8 Further studies revealed that A3G induces massive C3 U deamination of single stranded retroviral DNA, resulting in DNA degradation or lethal G3 A hypermutation. [9][10][11] Interestingly, A3G can also interfere with the HBV life c...

Interferon-inducible expression of APOBEC3 editing enzymes in human hepatocytes and inhibition of hepatitis B virus replication

“…[30][31][32][33] Inhibition of pregenomic HBV RNA packaging by A3G was originally proposed by Turelli et al 30 as the mode of action. This is in line with a recent investigation by Rösler et al, 33 who reported an increased nuclease sensitivity of core-protein associated full-length pregenomic HBV RNA on expression of A3G. The extent of hypermutations in replicating HBV DNA induced by APOBEC3 editing enzymes is another matter of debate.…”

“…20,42,43 Our study confirms the expression of A3G and A3F in normal human liver and proves the hepatic expression of A3B mRNA. Thus, the concluding statement of Rösler et al 33 that a role of APOBEC3 cytidine deaminases in the HBV life cycle is speculative because expression of cytidine deaminases in untransformed liver has not been shown has to be amended. All four cytidine deaminases expressed in normal human liver are up-regulated in primary hepatocytes on IFN-␣ stimulation, and A3B, A3F and A3G achieve at least moderate mRNA expression levels.…”

“…36,37 ⌬Ct values were standardized against an internal GAPDH control, and fold increase was calculated as (1ϩE) -⌬ ⌬Ct , relative to an unstimulated control at each time point. 33,34 The following primers were used: A3B: 3B4 (GGTCAGCAAT-TCATGCCTTGGTAC, nt 574-597), 3B5 (CCCTG TAGATCTGGGCCGGGTCC, as, nt 750-728). A3C: 3C4 (CCCCTCCACCCTGGACCC, nt 738-61); 3C5 (CGCAGGCTGGAGGAACGGGGTCTGT, as, nt 925-901).…”

“…29 In addition, two groups showed that A3G and also A3F, but not rat APOBEC-1, can inhibit the replication of HBV and of duck hepatitis B virus in transfected hepatoma cells in vitro. [30][31][32][33] Whether this inhibition of HBV replication in vitro is linked to catalytic cytidine deamination is unknown, and a non-editing mechanism has been proposed as the mode of inhibition. [30][31][32][33] The low or even absent expression of APOBEC3 genes in human liver, however, has raised the important question as to their impact on HBV replication in vivo.…”

“…[30][31][32][33] Whether this inhibition of HBV replication in vitro is linked to catalytic cytidine deamination is unknown, and a non-editing mechanism has been proposed as the mode of inhibition. [30][31][32][33] The low or even absent expression of APOBEC3 genes in human liver, however, has raised the important question as to their impact on HBV replication in vivo. Because IFN-␣ induces cellular pathways in hepatocytes that lead to a noncytolytic clearance of HBV, we investigated whether any of the APOBEC3 genes might be up-regulated in human primary hepatocytes in response to IFN-␣ and studied their effect on HBV replication, core-particle association, and HBV DNA editing in vitro.…”