Apamin-Sensitive Small Conductance Calcium-Activated Potassium Channels were Negatively Regulated by Captopril in Volume-Overload Heart Failure Rats

Abstract

In heart failure (HF), the malignant arrhythmias occur frequently; a study demonstrated that upregulation of I KAS resulted in recurrent spontaneous ventricular fibrillation in HF. However, the regulation of SK channels was poorly understood. The activation of SK channels depended on [Ca(2+)]i and PP2A; studies suggested that angiotensin II can regulate them. So, we hypothesized that in HF, the excess of angiotensin may regulate the SK channels and result in the remodeling of SK channels. To test the hypothesis, we used volume-overload-induced HF rat model, treated with captopril, performed whole-cell patch clamp to record apamin-sensitive currents (I KAS), and I-V curve was studied. The sensitivity of I KAS to [Ca(2+)]i was also explored by setting various [Ca(2+)]i (10, 100, 500, 900, 1000, and 10,000 nM), and the steady-state Ca(2+) response of I KAS was attained and performed Hill fitting with the equation (y = 1/[1 + (EC50/x) (n) ]). Immunofluorescent staining, real-time PCR, Western blot were also carried out to furtherly investigate the underlying molecular mechanisms of the regulation. Captopril significantly decreased the mean density of I KAS when [Ca(2+)]i was 500, 900, 1000, and 10000 nM. The Hill fitting showed significantly different EC50 values and the Hill coefficients and showed captopril significantly shifted rightward the steady-state Ca(2+) response of I KAS. The results of real-time PCR and Western blot demonstrated captopril decreased the mRNA and protein expression of SK3 channels. Captopril significantly downregulated the sensitivity of SK channels to [Ca(2+)]i and the SK3 channels expression in HF, and reversed the SK channels remodeling.

Dynamical effects of calcium‐sensitive potassium currents on voltage and calcium alternans

“…have reported that the EC 50 of the SK channel in rat ventricles is 0.23–0.59 μ m (Hongyuan et al . ). Chang et al .…”

“… b ; Hongyuan et al . ), which would profoundly shorten APD. We have chosen a range of g sk more conservatively (from 0.4 to 4 μS μF −1 ), based on apamin effects on APD.…”

LL-VNS attenuates SK2 expression and incidence of arrhythmias following acute myocardial infarction in rats

“…Real-time PCR assay of SK2 was performed in the same way as in a previously described study ( 13 ). For quantification of SK2 mRNA levels, total RNA was extracted via homogenization with TriReagent (Ambion, TX, USA).…”

CaMKII inhibitor KN‐93 impaired angiogenesis and aggravated cardiac remodelling and heart failure via inhibiting NOX2/mtROS/p‐VEGFR2 and STAT3 pathways

“…Quantitative PCR was performed as described previously by us. 33 Specific primer sequences of collagen I used for real‐time PCR were as follows: Collagen1, forward: 5′‐AAACCCGAGGTATGCTTGATCTGTA‐3′, reverse: 5′‐GTCCCTCGACTCCTACATCTTCTGA‐3′; Collagen Ⅲ, forward: 5′‐ACGTAAGCACTGGTGGACAG‐3′, reverse: 5′‐CAGGAGGGCCATAGCTGAAC‐3′; β‐actin, forward: 5′‐ACCCTGAAGTACCCCATGCAG‐3′, reverse: 5′‐ACATGATCTGGGTCATCTTGTGC‐3′. The relative level of mRNA was calculated by normalizing to β‐actin, according to the 2 −ΔΔ CT method.…”