Antioxidant properties and qualitative analysis of phenolic constituents in Ephedra spp. by HPTLC together with injection port derivatization GC–MS

Ibragić, Saida; Barbini, Stefano; Oberlerchner, Josua T.; Potthast, Antje; Rosenau, Thomas; Böhmdorfer, Stefan

doi:10.1016/j.jchromb.2021.122877

Cited by 14 publications

(6 citation statements)

References 33 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The antioxidant activity was measured according to the method developed by Brand-Williams et al (1995) [17], with slight modifications. DPPH (1, 1-diphenyl-2-picrylhydazyl) was used as the source of free radicals [18]. The absorbance of free radicals at 517 nm disappears upon their reduction by an antioxidant.…”

Section: Radical-scavenging Activity Assay and Total Polyphenol Contentmentioning

confidence: 99%

Streptococcus thermophilus and Lactobacillus bulgaricus Attributes as Influenced by Carao (Cassia grandis) Fruit Parts

Tabora,

Aleman,

Castro

et al. 2024

Bacteria

View full text Add to dashboard Cite

Carao (Cassia grandis) contains numerous bioactive substances that contribute to gastrointestinal well-being. The present study assessed the potential impacts of carao on the viability and performance of Streptococcus thermophilus and Lactobacillus bulgaricus under various adverse conditions. These conditions included bile, acid, gastric juice, and lysozyme exposure, simulating the digestive process from the mouth to the intestines. The activity of proteases from cultures was monitored to examine their proteolytic capabilities. To achieve this, the cultures were cultivated in a solution containing plant material, and the results were compared against a control sample after an incubation period. Subsequently, the total phenolic content, total carotenoid content, antioxidant activity, sugar profile, and acid profile of the plant materials were analyzed. These analyses were conducted to explore these compounds’ influence on cultures’ survival. Seeds contained the highest total phenols (766.87 ± 11.56 µg GAE/mL), total carotenoid content (7.43 ± 0.31 mg Q/mL), and antioxidant activity (40.76 ± 1.87%). Pulp contained the highest moisture (12.55 ± 0.44%), ash (6.45 ± 0.15%), lipid (0.66 ± 0.07%), protein (16.56 ± 0.21%), sucrose (9.07 ± 0.78 g/100 g), and fructose (3.76 ± 0.06 g/ 100 g). The crust had the highest content of ash (85.14 ± 0.27%) and succinic acid (2.01 ± 0.06 g/100 g). Results indicated that seeds negatively affected cultures’ survival in the bile tolerance test and had positive effects on Lactobacillus bulgaricus in the protease activity test. Otherwise, the other carao tissues could not change the results significantly (p > 0.05) compared to the control in different tests. The carao crust positively affected cultures’ against protease activity, especially in Lactobacillus bulgaricus, and had a negative effect on the growth of S. thermophilus in the lysozyme and gastric acid resistance test.

show abstract

Section: Radical-scavenging Activity Assay and Total Polyphenol Contentmentioning

confidence: 99%

Streptococcus thermophilus and Lactobacillus bulgaricus Attributes as Influenced by Carao (Cassia grandis) Fruit Parts

Tabora,

Aleman,

Castro

et al. 2024

Bacteria

View full text Add to dashboard Cite

show abstract

“…2019 study of the Chloroplast genomes of the three Ephedra species encoded 118 genes, including 73 protein-coding genes, 37 tRNA genes and 8 ribosomal RNA genes [ 309 ]; field surveys of Ephedra plants in the Zarayshan Mountains of Tajikistanto to determine total ephedrine and pseudoephedrine content [ 310 ]; characterization of the complete chloroplast genome of Ephedra sinica Stapf (Ephedraceae) [ 311 ]; chloroplast genome of Ephedra sinica (Ephedraceae) [ 312 ]; LC-MS/MS method for the determination of ephedrine in various food supplements [ 313 ]; capillary electrochromatography separation of ephedrine and pseudoephedrine isomers [ 314 ]; 2020 review of characterization methods to isolate compounds of Ephedra species characterized by MS-based techniques LC-MS, LC-ESI-MS, HPLC-PDA-ESI/MS, LC-DAD-ESI/MSn, LC/Orbitrap MS, etc. [ 315 ]; characterization of difference fractions of ephedra extracts and ephedrine alkaloids [ 316 ]; 2021 LC/MS quantitative analysis of ephedrine and pseudoephedrine in Ephedrae herba [ 317 ]; phytochemical fingerprint profile of the bioactive compounds from Ephedra fragilis including optimization of extraction and chemical characterization using RP-HPLC [ 318 ]; HPTLC supplemented with injection port derivatization GC-MS for analysis of ephedra herbal extracts [ 319 ]; DART-TOF-MS applied to whole plant bio-imaging of Ephedrae Herba for localization of major Ephedra Alkaloids [ 320 ]; identification of plant materials containing ephedrine alkaloids using DNA barcoding and TaqMan real-time PCR assay [ 321 ]; 2022 comparison of volatile oils and primary metabolites of raw and honey-processed ephedrae herba by GC-MS and chemometrics [ 322 ]; qualitative profiling of Ephedra alata monjauzeana using RP-HPLC-ESI-QTOF-MS [ 323 ]; relationship between ephedrine alkaloid profile in Ephedra gerardiana and soil characteristics [ 324 ]; characterization of the phyto-chemical profile of Ephedra alata subsp. alenda seeds extract using HPLC-ESI-QTOF-MS [ 325 ]; HPLC method for the simultaneous determination of five alkaloids (norephedrine, norpseudoephedrine, ephedrine, pseudoephedrine, and methylephedrine) in Ephedrae Herba [ 326 ]; collection of 224 ITS2 sequences representing 59 taxa within Ephedra and a 23-base pairs genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus signature and for the identification of Ephedra-containing products [ 327 ].…”

Section: Routine and Improved Analyses Of Abused Substancesmentioning

confidence: 99%

Interpol Review of Drug Analysis 2019-2022

Love

Jones

2023

Forensic Science International: Synergy

View full text Add to dashboard Cite

“…(Ephedraceae) were used to separate individual and quantify of some phenolic compounds (PCA, C, EC, Q and K) by HPLC-DAD. The plant material was used in previous original research (Ibragic et al, 2021)…”

Section: Source Of Plant Materialsmentioning

confidence: 99%

Catechins and other phenolic compounds in herb of eight Ephedra species in comparison to Camellia sinensis

Osmic

Čulum

Ibragić

2022

Natural Product Research

Self Cite

View full text Add to dashboard Cite

Using HPLC-DAD the presence of catechin, epicatechin, quercetin, kaempferol and protocatehuic acid was analysed in herb extracts of eight Ephedra species (Ephedra sinica, Ephedra major, Ephedra chilensis, Ephedra ciliata, Ephedra foeminea, Ephedra equisetina, Ephedra gerardiana and Ephedra distachya). For comparison purposes, the same phenolics were determined in Camellia sinensis herb, which is a common source of catechins and a medicinal plant with valuable antioxidant properties. The catechin content in Ephedra spp. ranged between 0.83 mg/g d.w. -8.77 mg/g d.w. , while the epicatechin content was between 0.11 mg/g d.w. -3.38 mg/g d.w. . In comparison to black tea, Ephedra major, Ephedra distachya and Ephedra equisetina had a higher catechin content. The selected Ephedra spp. are rich in catechins and the obtained results serve as the chemical rationale for the anti-inflammatory, antioxidant and anti-proliferative activities of Ephedra that are currently being investigated.

show abstract

Antioxidant properties and qualitative analysis of phenolic constituents in Ephedra spp. by HPTLC together with injection port derivatization GC–MS

Cited by 14 publications

References 33 publications

Streptococcus thermophilus and Lactobacillus bulgaricus Attributes as Influenced by Carao (Cassia grandis) Fruit Parts

Streptococcus thermophilus and Lactobacillus bulgaricus Attributes as Influenced by Carao (Cassia grandis) Fruit Parts

Interpol Review of Drug Analysis 2019-2022

Catechins and other phenolic compounds in herb of eight Ephedra species in comparison to Camellia sinensis

Contact Info

Product

Resources

About