Antimicrobial resistance and virulence genes of non-typhoidal Salmonella isolates in The Gambia and Senegal

Abstract

Introduction: The prevalence of virulence genes in non-typhoidal Salmonella (NTS) and its association with commonly used antibiotics in West Africa is unknown. Methodology: We tested 185 NTS isolates from children, animals, and food products for the presence of twelve virulence genes by PCR. Ten of the virulence genes tested belonged to the five Salmonella pathogenicity islands implicated in its pathogenesis. Results: Ten of twelve virulence genes except sopE and pefA were present in at least 70% of the isolates tested; sopE and pefA were observed in 33% and 44% of the isolates, respectively. The most prevalent gene was invA (99.5%), which is an invasion gene conserved within the Salmonella enterica. pipD and sopB genes, which were associated with serovar Enteritidis, were detected in 92.4% and 94.1% of isolates respectively. S. Istanbul and S. Javiana, which were isolated from chicken-serving restaurants, carried all the virulence genes of the five pathogenicity islands. There was significant association between sopB, sitC, orfLC, pipD and pefA virulence genes and resistance to commonly used antibiotics in Senegal and The Gambia, namely amoxicillin, ticarcillin, trimethoprim plus sulfamethoxazole, tetracycline, trimethoprim, spectinomycin, streptomycin, sulfonamides and nitrofurantoin. Conclusions: This study shows that virulence genes are present in NTS strains isolated from various sources. The significant association between some virulence genes and antibiotic resistance may have important implications with regard to the spread and persistence of resistance and virulence genes in Salmonella and to the prudent use of antimicrobial agents in humans and animals in West Africa.

Detection of Virulence Genes in Salmonella Serovars Isolated from Broilers

“…In this study, PCR assay was carried out for the detection of the invA gene from six isolated strains (S. enteritidis, S. macclesfield, S. rissen, S. derby, S. magherafelt and S. enterica sub.spp salamae) has revealed that the gene was present in all of the isolates (100%) that was demonstrated by the presence of a 284 bp PCR amplified fragment. The results obtained in the present study were in corroboration with [16]. PCR assay was carried out for the detection of the sopB gene from isolated strains has revealed that the gene was present in all of the isolates (100%) which was demonstrated by the presence of a 517 bp PCR product.…”

Antimicrobial susceptibility and molecular characterization of Salmonella serovar Ndolo isolated from outbreaks in cattle and horses

“…This suggested a potential pathogenic role for these isolates, as they were associated with infection and diarrhea in most of these animals (GAL-MOR & FINLAY, 2006;JENNINGS et al, 2012). The virulence genes identified were similar to those detected in other Salmonella serovars isolated from humans and animals (DIONE et al, 2011;JENNINGS et al, 2012;PARVATHI et al, 2011). These results also suggested the presence of at least three Salmonella pathogenicity islands (SPIs) (IOANNIDIS et al, 2013) in these isolates since invA, Ramos et al orgA, prgH, sipB, and spaN are commonly encoded in SPI-1, spiA in SPI-2, and sopB in SPI-5 (DIONE et al, 2011;SKYBERG et al, 2006).…”

Chrysomya putoria, a Putative Vector of Diarrheal Diseases

“…The presence of Salmonella spp. was investigated using primers invA.F (5′- CTGGCGGTGGGTTTTGTTGTCTTCTCTATT -3′) and invA.R (5′- AGTTTCTCCCCCTCTTCATGCGTTACCC -3′) targeting the invasion gene invA [21]. For the detection of E.coli spp.…”