Antibiotic Resistance and Distribution of Tetracycline Resistance Genes in
            <i>Escherichia coli</i>
            O157:H7 Isolates from Humans and Bovines

Wilkerson, Chris; Samadpour, Mansour; Kirk, Nicole van; Roberts, Marilyn C.

doi:10.1128/aac.48.3.1066-1067.2004

Cited by 61 publications

(56 citation statements)

References 10 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Tetracycline resistance determinants tetA, tetB, tetC, tetD, tetE and tetG were reported in tetracycline-resistant E. coli O157 [32] and E. coli O149:K91 [33]. In this study, tetA occurred at a high frequency (54%), followed by tetC (14%); however, other tetracycline resistance determinants were not detected.…”

Section: Discussioncontrasting

confidence: 62%

Characterization of antimicrobial resistance patterns and class 1 integrons in Escherichia coli O26 isolated from humans and animals

Srinivasan

Gillespie²,

Nguyen³

et al. 2007

International Journal of Antimicrobial Agents

View full text Add to dashboard Cite

Section: Discussioncontrasting

confidence: 62%

Characterization of antimicrobial resistance patterns and class 1 integrons in Escherichia coli O26 isolated from humans and animals

Srinivasan

Gillespie²,

Nguyen³

et al. 2007

International Journal of Antimicrobial Agents

View full text Add to dashboard Cite

“…Scott et al (2006) showed that E. coli O157:H7 strains isolated from cattle feedlots were susceptible to 13 tested antibiotics. In particular, different studies (Kim et al 1994;Galland et al 2001;Schroeder et al 2002;Wilkerson et al 2004) have evidenced that only from 6.63 to 38.46% of E. coli O157:H7 isolates from bovines were resistant to tetracycline. Various countries including Turkey have banned the usage of chloramphenicol for foodproducing animals, so this result is good data for chloramphenicol resistance.…”

Section: Resultsmentioning

confidence: 99%

Antibiotic resistance of Escherichia coli O157:H7 isolated from cattle and sheep

et al. 2010

View full text Add to dashboard Cite

A total of 102 Escherichia coli O157:H7 colonies recovered from 11 cattle and 14 sheep were collected and tested for their antibiotic resistance profiles using a disc diffusion method, according to the Clinical and Laboratory Standards Institute. Four (36.36 %) of the 11 cattle E. coli O157:H7 isolates were resistant to cephalothin, one (9.09 %) isolate was resistant to streptomycin, and one (9.09 %) to nalidixic acid. Two (14.28 %) of the 14 sheep E. coli O157:H7 isolates were resistant to sulphamethoxazole, one (7.14 %) isolate was resistant to sulphonamide compounds, and one (7.14 %) to streptomycin. All cattle and sheep isolates were found to be susceptible to cephazolin, gentamicin, ciprofloxacin, imipenem, trimethoprim/ sulphamethoxazole, chloramphenicol, trimethoprim, and ceftiofur. Six cattle isolates were susceptible at a ratio of 54.54 %, and 11 (78.57 %) isolates from sheep were susceptible to all 20 antibiotics tested. As an overall result, 68 % of the E. coli O157:H7 isolates belonging to cattle and sheep were susceptible to all antibiotics tested. On the other hand, most of the E. coli O157:H7 isolates were intermediately resistant to streptomycin, cephalothin, sulphamethoxazole, ampicillin, and kanamycin.

show abstract

“…Restriction endonuclease (EcoRV or AccI for strain HS1858 only)-digested plasmid DNA [for tet(B) blot] or MspI-digested H. parasuis strain 1543 genomic DNA and EcoRV-digested pHS-Tet ad pHS-Tet/pHSRec plasmid preparations (for tetR blot) were separated on 0.7% agarose gels and transferred to GeneScreen Hybridization Transfer membrane (NEN Life Science Products) by capillary action (3). A DNA fragment containing the tet(B) gene was amplified from pHS-Tet using primers BF and BR as previously described (22). A DNA fragment containing the Tn10 tetR gene was amplified from E. coli strain TST-1 genomic DNA using primers TetRfwd (5Ј-ATGATG TCTAGATTAGATAAAAGTAAAG) and TetRrev (5Ј-TTAAGACCCACTTT CACATTTAAGTTG).…”

Section: Methodsmentioning

confidence: 99%

Plasmid-Encoded Tet B Tetracycline Resistance in Haemophilus parasuis

Lancashire

Terry

Blackall³

et al. 2005

Antimicrob Agents Chemother

View full text Add to dashboard Cite

The complete sequence of two plasmids, pHS-Tet (5.1 kb) and pHS-Rec (9.5 kb), isolated from Haemophilus parasuis strain HS1543 has been obtained. Plasmid pHS-Tet contains four open reading frames including a tet(B) tetracycline resistance gene which unusually did not have an associated tetR repressor gene. From a total of 45 H. parasuis isolates surveyed (15 international reference strains, 15 field isolates selected for their genetic diversity, and 15 recent Australian field isolates), 2 tetracycline-resistant field isolates (HS226 and HS1859) were identified. Analysis of three additional isolates from the same disease outbreak as strain HS1859 revealed a further tetracycline-resistant H. parasuis strain (HS1857, serovar 8) and a tetracycline-resistant Actinobacillus pleuropneumoniae strain (HS1861). An approximately 10.6-kb plasmid was identified in field isolate HS226 and outbreak strains HS1857, HS1859, and HS1861. Southern hybridization analysis of these plasmids showed that the Tet B determinant was present, and restriction digest comparisons suggest that these plasmids are related. This is believed to be the first report of native H. parasuis plasmids and Tet B-mediated tetracycline resistance in this microorganism.Haemophilus parasuis is the causative agent of Glässer's disease in swine. Common symptoms of this disease include anorexia, pyrexia, and lameness, though some pigs may die suddenly during acute outbreaks (19).The use of antibiotics in animal production as treatment or prophylaxis against common infections or at subtherapeutic levels in feed to promote growth is under increasing scrutiny (11). Tetracycline has a long history of use in the swine industry (17), and its use generates a strong selective pressure that has resulted in the exchange of tetracycline resistance genes associated with plasmids or transposons within and between bacterial species (13). Tetracycline resistance determinants Tet B, Tet H, and Tet M have previously been found in other members of the Pasteurellaceae (7, 9). Tetracycline-resistant isolates of H. parasuis have previously been reported in Austria (15) and Denmark (1) although the mechanism of this resistance has not been elucidated.In this study, we have identified and sequenced two native H. parasuis plasmids, one of which encoded the Tet B tetracycline resistance determinant. A survey of tetracycline resistance was undertaken in 45 H. parasuis strains, identifying tet(B) plasmidmediated tetracycline resistance in two additional H. parasuis strains. One of these tetracycline-resistant field isolates was isolated from a disease outbreak involving both H. parasuis and Actinobacillus pleuropneumoniae. Tetracycline resistance determinant tet(B) was identified in an A. pleuropneumonie and a further H. parasuis isolate from this outbreak. MATERIALS AND METHODSBacteria. Escherichia coli strains were cultured in Luria-Bertani medium (LB) with appropriate antibiotics. Strain XL1-Blue MR (Stratagene) was used in electroporations using plasmid pHS-Tet, and strain TST-1 (E. co...

show abstract

Antibiotic Resistance and Distribution of Tetracycline Resistance Genes in Escherichia coli O157:H7 Isolates from Humans and Bovines

Cited by 61 publications

References 10 publications

Characterization of antimicrobial resistance patterns and class 1 integrons in Escherichia coli O26 isolated from humans and animals

Characterization of antimicrobial resistance patterns and class 1 integrons in Escherichia coli O26 isolated from humans and animals

Antibiotic resistance of Escherichia coli O157:H7 isolated from cattle and sheep

Plasmid-Encoded Tet B Tetracycline Resistance in Haemophilus parasuis

Contact Info

Product

Resources

About