Anti-leukemic activity of bortezomib and carfilzomib on B-cell precursor ALL cell lines

Abstract

Prognosis of childhood acute lymphoblastic leukemia (ALL) has been dramatically improved. However, prognosis of the cases refractory to primary therapy is still poor. Recent phase 2 study on the efficacy of combination chemotherapy with bortezomib (BTZ), a proteasome inhibitor, for refractory childhood ALL demonstrated favorable clinical outcomes. However, septic death was observed in over 10% of patients, indicating the necessity of biomarkers that could predict BTZ sensitivity. We investigated in vitro BTZ sensitivity in a large panel of ALL cell lines that acted as a model system for refractory ALL, and found that Philadelphia chromosome-positive (Ph+) ALL, IKZF1 deletion, and biallelic loss of CDKN2A were associated with favorable response. Even in Ph-negative ALL cell lines, IKZF1 deletion and bilallelic loss of CDKN2A were independently associated with higher BTZ sensitivity. BTZ showed only marginal cross-resistance to four representative chemotherapeutic agents (vincristine, dexamethasone, l-asparaginase, and daunorubicin) in B-cell precursor-ALL cell lines. To improve the efficacy and safety of proteasome inhibitor combination chemotherapy, we also analyzed the anti-leukemic activity of carfilzomib (CFZ), a second-generation proteasome inhibitor, as a substitute for BTZ. CFZ showed significantly higher activity than BTZ in the majority of ALL cell lines except for the P-glycoprotein-positive t(17;19) ALL cell lines, and IKZF1 deletion was also associated with a favorable response to CFZ treatment. P-glycoprotein inhibitors effectively restored the sensitivity to CFZ, but not BTZ, in P-glycoprotein-positive t(17;19) ALL cell lines. P-glycoprotein overexpressing ALL cell line showed a CFZ-specific resistance, while knockout of P-glycoprotein by genome editing with a CRISPR/Cas9 system sensitized P-glycoprotein-positive t(17;19) ALL cell line to CFZ. These observations suggested that IKZF1 deletion could be a useful biomarker to predict good sensitivity to CFZ and BTZ, and that CFZ combination chemotherapy may be a new therapeutic option with higher anti-leukemic activity for refractory ALL that contain P-glycoprotein-negative leukemia cells.

Resistance of t(17;19)‐acute lymphoblastic leukemia cell lines to multiagents in induction therapy

“…Sensitivity to VCR was also significantly enhanced by verapamil in both cell lines (Figure ). To directly verify involvement of P‐gp in DNR resistance of HALO1 cells, we next established P‐gp knocked out HALO1 cells using the CRISPR/Cas9 system with a CD4 reporter . P‐gp expression was knocked out in nearly half of the CD4‐positive population (Figure ) .…”

“…To directly verify involvement of P‐gp in DNR resistance of HALO1 cells, we next established P‐gp knocked out HALO1 cells using the CRISPR/Cas9 system with a CD4 reporter . P‐gp expression was knocked out in nearly half of the CD4‐positive population (Figure ) . Then, we treated the cells with DNR (12.5 ng/mL), VCR (25 ng/mL), or Dex (250 nmol/L), for 72 hours.…”

“…Four t(17;19)‐ALL cell lines (UOC‐B1, HALO1, YCUB2, and Endo‐kun) and 16 t(1;19)‐ALL cell lines (KOPN‐K, ‐34, ‐36, ‐54, ‐60, ‐63, YAMN‐90, ‐92, YCUB6, YCUB8, Kasumi2, SCMC‐L1, THP4, 697, RCH, and PreALP) were used in this study . As B‐precursor ALL cell lines, seven MLL ‐rearranged ( MLL +) ALL cell lines (KOPN‐1, KOCL‐33, ‐44, ‐45, ‐50, ‐58, and ‐69), six Philadelphia chromosome (Ph)‐positive ALL cell lines (KOPN‐30bi, ‐57bi, ‐66bi, ‐72bi, YAMN‐73, and SU‐Ph2), and eight other ALL cell lines (KOPN‐32, ‐35, ‐41, ‐62, ‐70, ‐79, Reh, and Nalm6) were used (Table ) . All cell lines were maintained in RPMI1640 medium supplemented with 10% fetal calf serum (FCS) in a humidified atmosphere of 5% CO 2 at 37°C.…”

“…To knockout P‐glycoprotein (P‐gp; ABCB1) expression with the CRISPR/Cas9 system, we selected 5′‐TTTGGCTGCCATCATCCATGG‐3′, which showed the highest off‐target hit score in the CRISPR design tool (CRISPR DESIGN, http://crispr.mit.edu), and the synthesized oligomers were cloned into CRISPR/Cas9 vectors (CRISPR CD4 Nuclease Vector, Thermo Fisher Scientific, Waltham, MA). Three days after electroporation of the ABCB1‐targeting CRISPR/Cas9 vector into HALO1 cells using the Neon electroporation transfection system (Thermo Fisher Scientific), CD4‐positive cells were selected using CD4 microbeads (Miltenyi Biotec, Auburn, CA) and expanded for further analyses …”

A Bortezomib-Based Protocol Induces a High Rate of Complete Remission with Minor Toxicity in Adult Patients with Relapsed/Refractory Acute Lymphoblastic Leukemia

“…The effect of bortezomib on the leukemic cells is related to their specific molecular and cytogenetic characteristics. Thus, Ph-positive B-ALL cell lines and cell lines harbouring a deletion of IKZF1 or a biallelic loss of CDKN2A were more sensitive to bortezomib [11]. Moreover, FoxO3 , a tumor suppressor gene acting downstream of the BCR-ABL signal transduction, is targeted by the proteasomal degradation pathway.…”