Annexin A11 knockdown inhibits in vitro proliferation and enhances survival of Hca-F cell via Akt2/FoxO1 pathway and MMP-9 expression

Liu, Shuqing; Wang, Jiasheng; Guo, Chunmei; Qi, Houbao; Sun, Ming‐Zhong

doi:10.1016/j.biopha.2015.01.011

Cited by 16 publications

(16 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…An unrelated targeting sequence GTTCTCCGAACGTGTCACGT was also designed as a negative control shRNA (NC-shRNA). The corresponding shRNAs for CRKL and NC were then inserted into the pGPU6/GFP/ Neo vectors according to our established methods [29,30], named as CRKL-shRNA-pGPU6/GFP/Neo (CRKL-shRNA) and NC-shRNApGPU6/GFP/Neo (NC-shRNA), respectively. 1 Â 10 5 Hca-P cells/ well were seeded into a 24-well plate in 500 mL of RPMI-1640 without antibiotic and cultured in a humidified environment at 37 8C with 5% CO 2 for 24 h. Transfection was performed on the following day when the cell reached 70% confluent with Lipofectamine TM 2000 (Life technologies, USA) according to the manufacturer's instructions.…”

Section: Establishment Of Crkl Knockdown Monoclonal Hca-p Cell Linementioning

confidence: 99%

CRKL knockdown promotes in vitro proliferation, migration and invasion, in vivo tumor malignancy and lymph node metastasis of murine hepatocarcinoma Hca-P cells

Meng

Sun

Guo

et al. 2015

Biomedicine & Pharmacotherapy

Self Cite

View full text Add to dashboard Cite

Section: Establishment Of Crkl Knockdown Monoclonal Hca-p Cell Linementioning

confidence: 99%

CRKL knockdown promotes in vitro proliferation, migration and invasion, in vivo tumor malignancy and lymph node metastasis of murine hepatocarcinoma Hca-P cells

Meng

Sun

Guo

et al. 2015

Biomedicine & Pharmacotherapy

Self Cite

View full text Add to dashboard Cite

“…We reported ANXA11 linked to hepatocarcinoma lymphatic metastasis as its level was 2-fold higher in Hca-P than Hca-F cells [ 39 ]. The stable knockdown of ANXA11 on in vitro migration, invasion and in situ adhesion capacity to LN of Hca-P cells was performed.…”

Section: Resultsmentioning

confidence: 99%

“…They are the ideal experimental subjects for investigating the “pure” underlying LNM in the malignant hepatocellular tumors deriving from epithelia [ 5 , 25 - 27 , 32 , 34 - 38 ]. We previously reported the protein expression level of ANXA11 in Hca-P was 2-fold higher than Hca-F cells [ 39 ], suggesting ANXA11 might act as a potential suppressor for the lymphatic metastasis of murine HCC.…”

Section: Introductionmentioning

confidence: 99%

ANXA11 regulates the tumorigenesis, lymph node metastasis and 5-fluorouracil sensitivity of murine hepatocarcinoma Hca-P cells by targeting c-Jun

et al. 2016

Self Cite

View full text Add to dashboard Cite

Annexin A11 (Anxa11) is associated with various cancers. Using a pair of syngeneic murine hepatocarcinoma cells, Hca-P with ~25% and Hca-F with ~75% lymph node metastatic (LNM) potentials, we demonstrated Anxa11 involvement in hepatocarcinoma lymphatic metastasis. Here, ANXA11 acted as a suppressor for the tumorigenicity, LNM and 5-FU resistance of Hca-P via c-Jun. We constructed monoclonal Hca-P cell line with stable ANXA11 knockdown. Although Bax and Bcl-2 levels increased in shRNA-Anxa11-transfected Hca-P, ANXA11 downregulation showed no clear effect on Hca-P apoptosis. ANXA11 downregulation promoted in vitro migration and invasion capacities of Hca-P. In situ adhesion potential of Hca-P cells toward LN was significantly enhanced following ANXA11 downregulation. Consistently, ANXA11 downregulation promoted the in vivo tumor growth and LNM capacities of Hca-P cells. ANXA11 knockdown enhanced the chemoresistance of Hca-P cells specifically toward 5-FU instead of cisplatin. Its downregulation increased c-Jun (pSer73) and decreased c-Jun (pSer243) levels in Hca-P. c-Jun (pSer243) downregulation seemed to be only correlated with ANXA11 knockdown without the connection to 5-FU treatment. Interestingly, compared with scramble-Hca-P cells, the levels of c-Jun and c-Jun (pSer73) in shRNA-Anxa11-Hca-P cells were upregulated in the presences of 0.1 and 1.0 mg/L 5-FU. The levels changes from c-Jun and c-Jun (pSer73) in Hca-P cells showed a more obvious tendency with the combination of ANXA11 knockdown and 5-FU treatment. ANXA11 level regulates LNM and 5-FU resistance of Hca-P via c-Jun pathway. It might play an important role in hepatocarcinoma cell malignancy and be a therapeutic target for hepatocarcinoma.

show abstract

“…So far, the mechanism that Anxa11 is involved in apoptosis exactly has not been discovered. A recent study indicated that the knockdown of Anxa11 decreased proliferation and survival of hepatocarcinoma cells by increasing expression of thymoma viral proto-oncogene 2 (AKT2) and phospholylated forkhead box O1 (FOXO1) [37]. Thus, this suggests that Anxa11 is involved in cell survival or apoptosis in different cell types.…”

Section: Discussionmentioning

confidence: 99%

Identification of target genes for spermatogenic cell-specific KRAB transcription factor ZFP819 in a male germ cell line

et al. 2017

View full text Add to dashboard Cite

Background Zfp819, a member of the Krüppel-associated box (KRAB) family, encodes a spermatogenic cell-specific transcription factor. Zfp819-overexpression induces apoptosis and inhibits proliferation in somatic cell lines.ResultsIn the present study, we examined the cellular effects of Zfp819 in a male germ cell line (GC-2 cells). Overexpression of Zfp819 demonstrated an increase in the number of apoptotic cells, leading to inhibition of proliferation in GC-2 cells. We further investigated genes regulated by ZFP819 using microarray analysis and chromatin-immunoprecipitation combined with microarray analysis (ChIP-chip) in GC-2 cells. We identified 118 downregulated genes in Zfp819-overexpressing GC-2 cells using microarray analysis. ChIP-chip assay revealed that 1011 promoter sites (corresponding to 262 genes) were specifically enriched in GC-2 cells transfected with Zfp819. Two genes (trinucleotide repeat containing 6b and annexin A11) were commonly found when we compared the data between microarray and ChIP-chip analyses. Consistent with these results, Zfp819 overexpression significantly reduced the transcript levels of the two genes by binding to their promoter regions. Tissue distribution analysis indicated that both genes were predominantly expressed in testis. It has been reported that these two genes function in apoptosis.ConclusionCollectively, our study provides inclusive information on germ cell-specific gene regulation by ZFP819, which is involved in apoptosis, to maintain the integrity of spermatogenesis.Electronic supplementary materialThe online version of this article (doi:10.1186/s13578-016-0132-4) contains supplementary material, which is available to authorized users.

show abstract

Annexin A11 knockdown inhibits in vitro proliferation and enhances survival of Hca-F cell via Akt2/FoxO1 pathway and MMP-9 expression

Cited by 16 publications

References 38 publications

CRKL knockdown promotes in vitro proliferation, migration and invasion, in vivo tumor malignancy and lymph node metastasis of murine hepatocarcinoma Hca-P cells

CRKL knockdown promotes in vitro proliferation, migration and invasion, in vivo tumor malignancy and lymph node metastasis of murine hepatocarcinoma Hca-P cells

ANXA11 regulates the tumorigenesis, lymph node metastasis and 5-fluorouracil sensitivity of murine hepatocarcinoma Hca-P cells by targeting c-Jun

Identification of target genes for spermatogenic cell-specific KRAB transcription factor ZFP819 in a male germ cell line

Contact Info

Product

Resources

About