Androgen receptor gene polymorphism influence fat accumulation: A longitudinal study from adolescence to adult age

Abstract

To determine the influence of androgen receptor CAG and GGN repeat polymorphisms on fat mass and maximal fat oxidation (MFO), CAG and GGN repeat lengths were measured in 128 young boys, from which longitudinal data were obtained in 45 of them [mean ± SD: 12.8 ± 3.6 years old at recruitment, and 27.0 ± 4.8 years old at adult age]. Subjects were grouped as CAG short (CAGS) if harboring repeat lengths ≤ 21, the rest as CAG long (CAGL); and GGN short (GGNS) if GGN repeat lengths ≤ 23, or long if > 23 (GGNL). CAGS and GGNS were associated with lower adiposity than CAGL or GGNL (P < 0.05). There was an association between the logarithm of CAG repeats polymorphism and the changes of body mass (r = 0.34, P = 0.03). At adult age, CAGS men showed lower accumulation of total body and trunk fat mass, and lower resting metabolic rate (RMR) and MFO per kg of total lean mass compared with CAGL (P < 0.05). GGNS men also showed lower percentage of body fat (P < 0.05). In summary, androgen receptor CAG and GGN repeat polymorphisms are associated with RMR, MFO, fat mass, and its regional distribution in healthy male adolescents, influencing fat accumulation from adolescence to adult age.

Androgen receptor gene polymorphisms and maximal fat oxidation in men. A longitudinal study.

“…In agreement, our data revealed that CAG L , who had 21.5% higher levels of free testosterone, also had greater MFO than CAG S , as previously reported in boys followed during 15 years from adolescence to adult age (12). This finding is important since it has been shown in men that low levels of testosterone increase the risk of all-cause and cardiovascular mortality, increase fat accumulation, reduced glucose utilization, glycolysis and mitochondrial oxidative phosphorylation (29), which could affect fatty acid oxidation capacity.…”

“…In contrast with the present findings, CAG S and GGN S had lower adiposity, fat accumulation than CAG L or GGN L in a longitudinal study from adolescence to adult age (~13 to ~27 years old) (12). Both studies show a beneficial influence of long CAG and GGN repeats on MFO, which could protect against the gain of fat mass over the years.…”

“…Approximately 6-7 years later, subjects reported back to the laboratory after an overnight fast for the measurement of body composition by DXA, RMR, MFO, and their VO 2 max by indirect calorimetry (12), and physical activity using the Minnesota Leisure Time Physical Activity Questionnaire (15). Subjects were requested to refrain from non-habitual exercise, caffeine or alcohol drinks for at least 24 hours before the test.…”

“…Short GGN repeats were also associated with a lower percentage of body fat compared to long GGN repeats (12). However, the former study did not include hormonal measurements, which are essential to understand the changes in body composition.…”

Identification of a novel 24 bp insertion–deletion (indel) of the androgen receptor gene and its association with growth traits in four indigenous cattle breeds

“…It is a master regulator that plays a vital role in the regulation of growth and the protection of endangered breeds. Current studies pay more attention to the function of lipometabolism and cancer, placing almost no focus on animal growth and development (Cameron et al, 2016;Ponce-González et al, 2016;Hu et al, 2017;Recouvreux et al, 2017). Herein, we first confirmed the existence of a novel 24 bp indel (AC_000187.1g.4187270-4187293del AATTTATTGGGAGATTATTGAATT) within the intron of cattle AR genes in four breeds of indigenous cattle.…”