Analyzing Homologous Recombination at a Genome-Wide Level

Abstract

DNA double-strand breaks (DSBs) are harmful lesions that severely challenge genomic integrity, and recent evidence suggests that DSBs occur more frequently on the genome than previously thought. These lesions activate a complex and multilayered response called the DNA damage response, which allows to coordinate their repair with the cell cycle progression. While the mechanistic details of repair processes have been narrowed, thanks to several decades of intense studies, our knowledge of the impact of DSB on chromatin composition and chromosome architecture is still very sparse. However, the recent development of various tools to induce DSB at annotated loci, compatible with next-generation sequencing-based approaches, is opening a new framework to tackle these questions. Here we discuss the influence of initial and DSB-induced chromatin conformation and the strong potential of 3C-based technologies to decipher the contribution of chromosome architecture during DSB repair.

Quantification of protein enrichment at site-specific DNA double-strand breaks by chromatin immunoprecipitation in cultured human cells

“…The Legube group has validated an antibody from Abcam (#ab176458, RRID: AB_2665405 ) as a replacement. 15 Wash the Protein A or G Dynabeads. Note: As much as possible, Protein A or G Dynabeads should be kept on ice or at 4°C.…”

“…The Legube group has validated an antibody from Abcam (#ab176458, RRID: AB_2665405 ) as a replacement. 15 …”

“…Primers compatible with RAD51 recruitment that we have tested include the pairs for positions p1 and p4 in U2OS-DSB reporter cells and the pair for the locus HR-DSB2. 15 Note: As negative controls, we list primer pairs that amplify regions far from the induced DSB sites, such as Control Region for Asi SI-ER U2OS cells and Chromosome 7 for U2OS-DSB reporter cells. As these genomic loci are distal from the induced DSBs, the enrichment of DSB repair proteins (and hence the ChIP signal) should be minimal.…”

“…Primers compatible with RAD51 recruitment that we have tested include the pairs for positions p1 and p4 in U2OS-DSB reporter cells and the pair for the locus HR-DSB2. 15 …”

“… 11 , 15 HR-DSB2 Rev b CTCACCCTTGCAGCACTTG Control region For c AGCACATGGGATTTTGCAGG Arnould et al. 15 Control region Rev c TTCCCTCCTTTGTGTCACCA a Other primers to regions proximal and distal to Asi SI cut sites on chromosomes 1, 6, and 22 are available. 13 The ones provided here are ones which we have used previously.…”