Analysis of the Eukaryotic Community and Metabolites Found in Clay Wall Material Used in the Construction of Traditional Japanese Buildings

Optimisation of the critical medium components for better growth of Picochlorum sp. and the role of stressful environments for higher lipid production

“…The chromosomal DNA of the CTM 20019 microalgal strain was isolated by the CTAB method . Microalgal 18S rRNA gene fragments were amplified by polymerase chain reaction using the primers EukA (5′‐AACCTGGTTGATCCTGCCAGT‐3′) and EukB (5′‐TGATCCTTCTGCAGGTTCACCTAC‐3′) . Polymerase chain reaction was performed in a total volume of 25 µL reaction mixture containing approximately 50 ng of genomic DNA (diluted 100×), 5 µL 10× Dream Taq buffer (MBI Fermentas, St. Leon‐Rot, Germany), 500 µmol L −1 of each deoxynucleoside triphosphate, 0.2 µmol L −1 of each primer (EukA and EukB) and 2.5 U of Dream Taq DNA polymerase (Fermentas).…”

“…19 Microalgal 18S rRNA gene fragments were amplified by polymerase chain reaction using the primers EukA (5 -AACCTGGTTGATCCTGCCAGT-3 ) and EukB (5 -TGATCCTTCTGCAGGTTCACCTAC-3 ). 20 Polymerase chain reaction was performed in a total volume of 25 µL reaction mixture containing approximately 50 ng of genomic DNA (diluted 100×), 5 µL 10× Dream Taq buffer (MBI Fermentas, St. Leon-Rot, Germany), 500 µmol L −1 of each deoxynucleoside triphosphate, 0.2 µmol L −1 of each primer (EukA and EukB) and 2.5 U of Dream Taq DNA polymerase (Fermentas). Thermal cycling consisted of an initial denaturation of 3 min at 94 • C, followed by 30 cycles of 45 s at 94 • C, 1 min at 60 • C, 3 min at 72 • C, and a final extension of 5 min at 72 • C. The 18S rDNA was cloned in the pGEMTEasy VectorSystem (Promega, Madison, USA).…”

Investigation of the Fermentation Mode of Rice Husk for the Stabilization of Earth Plaster

“…The pH of the RHg solution changes very little (around 7.8 -7) compared to that of RHp which becomes more acidic after three weeks of fermentation (6.1 to 4.6). The decrease in the pH of the solution over time would be due to the extraction of polysaccharide substances (cellulose, hemicelluloses, starches and pectins) which would be acids according Sakihito et al [19]. It is also possible that these are the degradation products of rice cell walls, released and solubilized by microbial fermentation (cellulose, hemicellulose, or lignin).…”