Analysis of local helix bending in crystal structures of DNA oligonucleotides and DNA-protein complexes

Abstract

Sequence-dependent bending of the helical axes in 112 oligonucleotide duplex crystal structures resident in the Nucleic Acid Database have been analyzed and compared with the use of bending dials, a computer graphics tool. Our analysis includes structures of both A and B forms of DNA and considers both uncomplexed forms of the double helix as well as those bound to drugs and proteins. The patterns in bending preferences in the crystal structures are analyzed by base pair steps, and emerging trends are noted. Analysis of the 66 B-form structures in the Nucleic Acid Database indicates that uniform trends within all pyrimidine-purine and purine-pyrimidine steps are not necessarily observed but are found particularly at CG and GC steps of dodecamers. The results support the idea that AA steps are relatively straight and that larger roll bends occur at or near the junctions of these A-tracts with their flanking sequences. The data on 16 available crystal structures of protein-DNA complexes indicate that the majority of the DNA bends induced via protein binding are sharp localized kinks. The analysis of the 30 available A-form DNA structures indicates that these structures are also bent and show a definitive preference for bending into the deep major groove over the shallow minor groove.

Distribution of bending propensity in DNA sequences

“…It thus appears that the bendability of DNA can be a major factor underlying both intrinsic and induced curvature. A similar conclusion was reached recently by Young and coworkers [21], based on a comprehensive analysis of DNA crystal structures. The second finding is that the bendability distribution in some DNA sequences, such as the kinetoplast DNA, is characteristically non-random, and is conserved in evolutionarily related examples.…”

“…Also, protein-induced bending at TATA sequences seems to be especially pronounced [13][14][15][16][17]. The lowest bendability value, on the other hand, is associated with poly(dA) motifs, which is also in agreement with experimental data, obtained by nucleosome studies [9,17] and X-ray crystallography [20,21]. It is interesting to note that the motifs of highest helical asymmetry index are in fact the properly positioned combinations of these two type of segments (i.e.…”

Characterization of polyamine synthesis pathway in Bacillus subtilis 168

“…Upstream from this box is a ¹35 box (TTTACT), similar to the consensus sequence typical of sigma A-dependent promoters. The sequence displays some remarkable features: it is predicted to be strongly bent in its upstream 5Ј end (3 amino acid runs spaced by one helix turn; Young et al, 1995); the bend is followed by a palindromic site strongly reminiscent of operators binding helix-turnhelix regulators (ATTTGTCATTGCATCCACAAC; Jansen et al, 1987;Gunasekera et al, 1992); finally, a repetition of 16 nt (CNTCTNTACTTTTTCC), which could constitute a binding site for a repressor molecule, overlaps the ¹35 and ¹10 boxes. Polyamines are nitrogen-containing molecules; however, no sigma 54 signature suggesting a direct nitrogen control could be found (Dé barbouillé et al, 1991).…”

DNA Structural Similarity in the 2:1 Complexes of the Antitumor Drugs Trabectedin (Yondelis) and Chromomycin A3with an Oligonucleotide Sequence Containing Two Adjacent TGG Binding Sites on Opposing Strands

“…The magnitude and directionality of the bending was related to the local helicoidal parameters roll and tilt, and quantified in terms of the angle of axis deflection () and its orientation relative to the major groove (). Graphical display of these quantities for individual base pair steps was performed using polar plots that allow both the magnitude and the direction of the helical bend to be represented in the form of "bending dials" (Young et al, 1995), in which and are the radial and angular coordinates, respectively. Points on the northern hemisphere of the dial reflect positive roll and compression of the major groove, whereas bending into the minor groove is plotted on the southern hemisphere.…”

“…This twist-roll relationship is also valid for G6/C7 in that this step displays both negative roll and the largest helical twist within the TGGCCA sequence. Because roll and tilt components are known to contribute to bending of the double helix (Young et al, 1995), these values were calculated and displayed in the form of "bending dials" (Fig. 4).…”