Analysis of Human Immunodeficiency Virus Type 1 mRNA Splicing Patterns during Disease Progression in Peripheral Blood Mononuclear Cells from Infected Individuals

Equine infectious anemia virus (EIAV) infection of horses is characterized by recurring cycles of disease and viremia that typically progress to an inapparent infection in which clinicalEquine infectious anemia virus (EIAV) is unique among lentiviruses in that the clinical course of infection in equids results initially in a rapid and dynamic series of clearly demarcated cycles of disease and associated viremia that begin by 3 weeks postinfection and continue at irregular intervals separated by weeks or months (reviewed in reference 25). Disease cycles last 3 to 5 days and are characterized by fever, diarrhea, lethargy, edema, anemia, and thrombocytopenia. This stage of disease, defined as chronic equine infectious anemia (EIA), typically lasts about 8 to 12 months postinfection, with the frequency and severity of clinical episodes decreasing with time. In contrast to the progressive degenerative disease associated with most lentiviral infections, horses infected with EIAV typically make a transition during the first year postinfection from chronic EIA to an inapparent infection in which clinical symptoms are absent and viremia is usually undetectable for the remainder of the animal's life span of up to about 20 years. Thus, the EIAV systems provides a novel model in which to examine the dynamics of lentivirus replication during clearly defined cycles of disease and during long-term asymptomatic infections.Several lines of evidence indicate that the control of EIAV replication and disease in long-term inapparent carriers is mediated by virus-specific host immune responses that evolve during the first year postinfection to achieve an enduring effective suppression of virus replication. For example, experimental infection of foals with severe combined immunodeficiency results in a progressive infection leading to death, demonstrating the necessity of the host immune system in accomplishing the temporal control of virus replication associated with infection of immunocompetent horses (29). In addition, it has been shown that severe stress or treatment of long-term inapparent carriers with immunosuppressive drugs can cause recrudescence of viremia and disease, even after decades of clinical quiescence (16,48). Finally, it has been demonstrated that transfer of whole blood from long-term inapparent carriers to naive horses results in EIAV infection and disease in the recipient horses (12). Taken together, these observations demonstrate the lack of attenuation of the infect-* Corresponding author. Mailing address:

Section: Clinical Profiles Of Eiav Experimentally Infected Animalsmentioning

confidence: 86%

Tissue Sites of Persistent Infection and Active Replication of Equine Infectious Anemia Virus during Acute Disease and Asymptomatic Infection in Experimentally Infected Equids

Harrold

Cook

et al. 2000

“…ADAR1 RNA was detected using the primers ADAR (ϩ) 1900 (17) and ADAR1 (Ϫ) (AGCGTAGGATTTTGTCACTAC) for 30 PCR cycles (50°C for 30 min, 95°C for 15 min, and cycling at 94°C for 30 s, 51°C for 30 s, and 72°C for 30 s); ADAR2 RNA detection using primers ADAR2 (ϩ) (GATGGTCAG TTCTTTGAAGG) and ADAR2 (Ϫ) (GGTCAGGTCACCAAACTTAC) for 35 cycles (50°C for 30 min, 95°C for 15 min, and cycling at 94°C for 30 s, 55°C for 45 s, and 72°C for 30 s); and MLN51 using primers (ϩ)MLN51 (TACTTTTCT GCTCCAGGCGT) and (Ϫ)MLN51 (TTACAACCTCAGGTGGAGGG) for 35 cycles (50°C for 30 min, 95°C for 15 min, and cycling at 94°C for 30 s, 55°C for 45 s, and 72°C for 30 s). The following primers were used to detect the expression of specific genes: MxA forward and reverse (13); BSS and GAGA (27) for unspliced HIV-1 RNA; BSS and SJ47A (27) for multiply spliced HIV-1 RNA; E14134 and E14135 (21) for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA; and E14134 and GADPH-intron (24) for GAPDH premRNA.…”

Section: Methodsmentioning

confidence: 99%

Double-Stranded RNA Adenosine Deaminases Enhance Expression of Human Immunodeficiency Virus Type 1 Proteins

Phuphuakrat¹,

Kraiwong

Boonarkart³

et al. 2008

104

ADARs (adenosine deaminases that act on double-stranded RNA) are RNA editing enzymes that catalyze a change from adenosine to inosine, which is then recognized as guanosine by translational machinery. We demonstrate here that overexpression of ADARs but not of an ADAR mutant lacking editing activity could upregulate human immunodeficiency virus type 1 (HIV-1) structural protein expression and viral production. Knockdown of ADAR1 by RNA silencing inhibited HIV-1 production. Viral RNA harvested from transfected ADAR1-knocked-down cells showed a decrease in the level of unspliced RNA transcripts. Overexpression of ADAR1 induced editing at a specific site in the env gene, and a mutant with the edited sequence was expressed more efficiently than the wild-type viral genome. These data suggested the role of ADAR in modulation of HIV-1 replication. Our data demonstrate a novel mechanism in which HIV-1 employs host RNA modification machinery for posttranscriptional regulation of viral protein expression.Human immunodeficiency virus (HIV) uses many host cellular machineries for its replication. Posttranscriptional modifications of the HIV type 1 (HIV-1) RNA, i.e., alternative splicing, capping, and poly(A) synthesis of the viral pre-mRNA, have been well described (15). However, the process of RNA editing, another subtle type of pre-mRNA modification, is still not well defined, and its role in HIV-1 replication is in doubt.RNA editing was found to be an important process in regulating gene expression in many eukaryotes and viruses. In hepatitis D virus, the process of RNA editing has been well studied (reviewed in reference 3). A-to-I editing converts a stop codon into a Trp codon, providing envelope protein for virion assembly (4, 25). In the hepatitis C replicon, ADAR1 was shown to abolish replication through editing (33). Hypermutation by RNA editing was found in measles virus mRNA. It is speculated that this process leads to persistence of the virus (5). The editing has also been found in other viruses, such as parainfluenza virus 3 (9), mumps virus (22), and Ebola virus (28).Evidence of RNA editing in HIV-1 has also been demonstrated. Edited adenosine in the (transactivating response region) (TAR) when the virus is injected into Xenopus oocytes has been reported (31), though the functional consequences of this conversion are not known. It is hypothesized that the phenomenon caused a change in the secondary structure of TAR, which may affect transcription and translation of the viral RNA. Base modification of A to G and C to U has also been shown in the HIV-1 transcript (1). The modification was proposed to play a role in modulation of viral gene expression.There are many data suggesting that RNA editing might be involved in HIV-1 gene expression. ADARs are the RNA editing enzymes of interested that may be involved in modulation of HIV-1 expression. It was demonstrated that mouse ADAR1 but not ADAR2 is upregulated in lymphocytes in response to inflammation (34). In this study, we demonstrated that ADARs could enhance H...

“…With alternative splicing of a single genomic RNA, HIV-1 can generate 47 different mRNA species (65). It was therefore necessary to design RT-PCR primers without any bias for a particular transcript type (66,67). Three classes of these nested primers were used.…”

Section: Presence Of Low Levels Of Spliced and Unspliced Hiv-1 Rna Inmentioning

confidence: 99%

Analysis of Human Immunodeficiency Virus Type 1 Transcriptional Elongation in Resting CD4⁺T Cells In Vivo

Lassen

Bailey

Siliciano

2004

135

140

A stable latent reservoir for human immunodeficiency virus type 1 (HIV-1) in resting memory CD4؉ T cells presents a barrier to eradication of the infection even in patients on highly active antiretroviral therapy. Potential mechanisms for latency include inaccessibility of the integrated viral genome, absence of key host transcription factors, premature termination of HIV-1 RNAs, and abnormal splicing patterns. To differentiate among these mechanisms, we isolated extremely pure populations of resting CD4 ؉ T cells from patients on highly active antiretroviral therapy. These cells did not produce virus but retained the capacity to do so if appropriately stimulated. Products of HIV-1 transcription were examined in purified resting CD4 ؉ T cells. Although short, prematurely terminated HIV-1 transcripts have been suggested as a marker for latently infected cells, the production of short transcripts had not been previously demonstrated in purified populations of resting CD4 ؉ T cells. By separating RNA into polyadenylated and nonpolyadenylated fractions, we showed that resting CD4 ؉ T cells from patients on highly active antiretroviral therapy produce abortive transcripts that lack a poly(A) tail and that terminate prior to nucleotide 181. Short transcripts dominated the pool of total HIV-1 transcripts in resting CD4 ؉ T cells. Processive, polyadenylated HIV-1 mRNAs were also present at a low level. Both unspliced and multiply spliced forms were found. Taken together, these results show that the nonproductive nature of the infection in resting CD4 ؉ T cells from patients on highly active antiretroviral therapy is not due to absolute blocks at the level of either transcriptional initiation or elongation but rather relative inefficiencies at multiple steps.