Analysis of DNA methylation reveals a partial reprogramming of the Müller glia genome during retina regeneration

Abstract

Upon retinal injury, zebrafish Müller glia (MG) transition from a quiescent supportive cell to a progenitor cell (MGPC). This event is accompanied by the induction of key transcription and pluripotency factors. Because somatic cell reprogramming during induced pluripotent stem cell generation is accompanied by changes in DNA methylation, especially in pluripotency factor gene promoters, we were interested in determining whether DNA methylation changes also underlie MG reprogramming following retinal injury. Consistent with this idea, we found that genes encoding components of the DNA methylation/demethylation machinery were induced in MGPCs and that manipulating MGPC DNA methylation with 5-aza-2′-deoxycytidine altered their properties. A comprehensive analysis of the DNA methylation landscape as MG reprogram to MGPCs revealed that demethylation predominates at early times, whereas levels of de novo methylation increase at later times. We found that these changes in DNA methylation were largely independent of Apobec2 protein expression. A correlation between promoter DNA demethylation and injurydependent gene induction was noted. In contrast to induced pluripotent stem cell formation, we found that pluripotency factor gene promoters were already hypomethylated in quiescent MG and remained unchanged in MGPCs. Interestingly, these pluripotency factor promoters were also found to be hypomethylated in mouse MG. Our data identify a dynamic DNA methylation landscape as zebrafish MG transition to an MGPC and suggest that DNA methylation changes will complement other regulatory mechanisms to ensure gene expression programs controlling MG reprogramming are appropriately activated during retina regeneration.repair | multipotent | Ascl1 | bisulfite sequencing | DNA sequencing I nduced pluripotent stem cells (iPSCs) can be generated through the forced expression of pluripotency factor genes, such as Oct4, Klf4, Sox2, c-Myc, Lin28, and Nanog, which are normally expressed in embryonic stem cells (ESCs) (1, 2). Pluripotency factor gene expression in ESCs and iPSCs is associated with chromatin that is in an "open" accessible state, whereas their repression in somatic cells is associated with less accessible, condensed chromatin (3). DNA methylation has a significant impact on chromatin structure (3). DNA demethylation of pluripotency factor promoter regions is correlated with increased expression during iPSC formation (4, 5). Similar epigenetic changes are seen in other cellular reprogramming events such as nuclear transfer (6), heterokaryon formation (7), and carcinogenesis (8).Tissue regeneration provides another avenue to study cellular reprogramming. Unlike mammals, zebrafish can regenerate multiple tissues, including the retina. During zebrafish retina regeneration, Müller glia (MG) reprogram to generate progenitor cells (MGPCs) capable of replacing all lost neural cell types (9-12). The role that MG play during this regenerative event can be roughly divided into three phases: the replication-independent transition of MG to...

Zinc-binding Domain-dependent, Deaminase-independent Actions of Apolipoprotein B mRNA-editing Enzyme, Catalytic Polypeptide 2 (Apobec2), Mediate Its Effect on Zebrafish Retina Regeneration

“…Retina lesions and BrdU injections have been described previously (7,16). Briefly, while anesthetized in 0.02% tricaine methane sulfonate, fish were placed under a dissecting microscope for visualization, and the right eye was gently rotated in its socket and stabbed through the sclera with a 30-gauge needle.…”

“…MO delivery to cells was facilitated by electroporation as described (7). The control, apobec2a, apobec2b, and ube2i targeting MOs have been described previously (7,12,16,22,23). The coding sequence of the pou6f2 MO is CATGAGAAGCATCTACTCAAAGGTC (5Ј 3 3Ј).…”

“…Here we build upon our previous work aimed at determining the mechanism by which Apobec2 proteins regulate retina regeneration (7,16). Through a combination of bacterial expression assays, transgenic fish, and site-directed mutagenesis, we demonstrate that although zebrafish Apobec2 proteins lack detectable zinc-dependent cytosine deaminase activity, their zinc-binding domain is critical for their function during retina regeneration.…”

“…ϩ cells from uninjured gfap:gfp (isolation of MG) and 4-day post injury (dpi) 1016 tuba1a:gfp transgenic fish (isolation of MGPCs) was carried out as described previously (16). Briefly, zebrafish retinas were collected in 0.8 ml of Leibovitz's L15 medium, treated for 15 min with 1 mg/ml hyaluronidase (Sigma) at room temperature, and then dissociated in 0.01% (v/v) trypsin with frequent trituration.…”

“…One of the ways they influence these events is by directly or indirectly stimulating expression of the ascl1a gene (7), a gene that encodes a transcriptional activator necessary for retina regeneration (14,15). Interestingly, knockdown of Apobec2a,2b during retina regeneration does not influence the changes in DNA methylation that accompany retina regeneration, indicating that Apobec2 proteins perform an alternate function (16).…”