Analysis of Distinct Tartrate-resistant Acid Phosphatase Promoter Regions in Transgenic Mice

Abstract

The tartrate-resistant acid phosphatase (TRAP) is present in multiple tissues, including kidney, liver, lung, spleen, and bone. Recent study of (TRAP) gene expression has provided evidence for distinct promoters within the (TRAP) gene, suggesting that the gene has alternative, tissue-preferred mRNA transcripts. Examination of endogenous (TRAP) exon 1B and 1C mRNA transcripts revealed tissue-preferred transcript abundance with increased exon 1B transcripts detected in liver and kidney and increased exon 1C transcripts detected in bone and spleen. In this investigation, we have made transgenic mice that express a marker gene driven by two candidate promoters, designated BC and C, within the (TRAP) gene. The BC and C promoters are 2.2 and 1.6 kb, respectively, measured from the translation initiation site. Evaluation of BC transgenic lines demonstrated robust expression in multiple tissues. In contrast, significant transgene expression was not detected in C transgenic lines. Evaluation of transgene mRNAs in BC transgenic lines revealed that virtually all expression was in the form of B transcripts, suggesting that the tissue-preferred pattern of endogenous (TRAP) was not replicated in the BC transgenic line. Likewise, osteoclastogenic cultures from BC, but not C, transgenic bone marrow cells expressed the transgene following receptor activator of NFB ligand/macrophage colonystimulating factor stimulation. In conclusion, when compared with the 2.2-kb BC portion of the (TRAP) promoter region, the 1.6-kb C portion does not account for significant gene expression in vivo or in vitro; production of the bone-and spleen-preferred (TRAP) C transcript must depend on regulatory elements outside of the 2.2-kb promoter. As the majority of currently investigated transcription factors that influence transcriptional regulation of osteoclast gene expression bind within the 1.6-kb C portion of the (TRAP) promoter, it is likely that transcription binding sites outside of the 2.2-kb region will have profound effects on regulation of the gene in vivo and in vitro.

Targeted Overexpression of Osteoactivin in Cells of Osteoclastic Lineage Promotes Osteoclastic Resorption and Bone Loss in Mice

“…The OA expression is driven by TRAP-1B/C promoter. Very briefly, the pGL3-TRAP-1B/C- Luc plasmid [30] was a generous gift from Dr. A. Ian Cassady of the University of New England in Armidale, New South Wales, Australia. The pGL3-TRAP-1B/C- OA expression plasmid (Fig.…”

“…The objective of this study was to determine whether osteoclast-derived OA has a regulatory role in bone resorption in vivo by determining the effects of targeted overexpression of OA in cells of osteoclastic lineage with the tartrate-resistant acid phosphatase (TRAP) exon 1B/C promoter to drive transgenic OA expression in bone in vivo . We chose the TRAP-1B/C promoter over the TRAP-1C promoter, which we used previously to generate transgenic mice with targeted overexpression of an osteoclast-specific protein-tyrosine phosphatase in osteoclasts [29], because the TRAP-1B/C promoter is a stronger promoter than the TRAP-1C promoter in vivo [30], although the TRAP-1B/C promoter is less specific for osteoclasts than the TRAP-1C promoter [31].…”

Osteoclasts Direct Bystander Killing of Bone Cancer

“…Transgenic mice (Tg/NCD) expressing the CD gene regulated by the osteoclastic tartrate-resistant acid phosphatase (TRAP) promoter (15) were used to determine if CD-expressing osteoclasts can direct the killing of cancer cells. In vitro experiments treated cocultures containing Tg/NCD osteoclast and tumor cells with 5-FC.…”

“…Previously described transgenic mice (Tg/NCD) on a C3H background were used (15). These mice have a fusion gene containing a marker gene (NGFR)(N) and the CD gene under regulation of the osteoclast TRAP gene promoter.…”

“…Expression levels of mRNA were determined using two-step quantitative real-time PCR, with SYBR green as a detection method as previously described (15). Three sets of primer pairs were used: (a) NCD (transgene), CAGAACAAGACCTCATAGCC ( forward), GACATCCGCCAATAGGAACA (reverse); (b) endogenous TRAP CCAATGC-CAAAGAGATCGCC ( forward), TCTGTGCAGAGACGTTGCCAAG (reverse); and (c) hypoxanthine phosphoribosyltransferase (HPRT), GTAATGAT-CAGTCAACGGGGGAC (forward), CCAGCAAGCTTGCAACCTTAACCA (reverse).…”