Analysis of a 43.6 kb deletion in a patient with Hunter syndrome (MPSII): Identification of a fusion transcript including sequences from the geneW and theIDS gene

Lagerstedt, Kristina; Carlberg, Britt-Marie; Kariminejad, Roxana; Kleijer, Wim J.; Bondeson, Marie Louise

doi:10.1002/(sici)1098-1004(200004)15:4<324::aid-humu4>3.0.co;2-5

Cited by 11 publications

(5 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Thus, the possible in uence of genes in the vicinity of the IDS gene cannot be excluded. The IDS region comprises several genes of unknown function, which can be included in deletions or complex rearrangements (14), though this effect of contiguous gene(s) has not been demonstrated to date (14,15). Among the nonsense mutations, only the Q531X mutation is responsible for a mild phenotype (6,16).…”

Section: Discussionmentioning

confidence: 99%

Mucopolysaccharidosis type II – genotype/phenotype aspects

Froissart

Silva²,

Guffon

et al. 2002

Acta Paediatrica

View full text Add to dashboard Cite

Establishing correlations between a patient's genotype and clinical phenotype is based on the assumption that the same clinical consequences will be observed in individuals with the same residual function of a speci c metabolic step. In mucopolysaccharidosis type II (MPS II; Hunter disease), patients present with a wide clinical spectrum. Furthermore, current methods for measuring the activity of the de cient enzyme in MPS II -iduronate-2-sulphatase (IDS) -are insuf ciently sensitive to differentiate between complete absence of activity and the presence of residual activity. Attempts have therefore been made to establish genotype-phenotype correlations in order to explain the large degree of heterogeneity and to serve as a better guide to prognosis on which to base genetic counselling and treatment options. Using MPS II as an example, this paper illustrates the dif culties and potential advantages of determining genotype-phenotype correlations in lysosomal storage diseases. The response of patients with MPS II to allogenic bone marrow transplantation provides some insight into the likely in uence of certain genotypes on therapeutic ef cacy.Conclusions: Evaluation of residual activity of IDS in MPS II using gene analysis, expression studies and transcript analysis does not always allow prediction of a patient's phenotype. The variable response to bone marrow transplantation, however, illustrates the potential importance of determining the genotype for selecting the most appropriate therapy for individual patients.

show abstract

Section: Discussionmentioning

confidence: 99%

Mucopolysaccharidosis type II – genotype/phenotype aspects

Froissart

Silva²,

Guffon

et al. 2002

Acta Paediatrica

View full text Add to dashboard Cite

show abstract

“…To date, over 350 mutations in this gene have been described (The Human Mutation Gene Database, http://www.hgmd. cf.ac.uk/ac/index.php), and phenotype-genotype correlations are difficult due to this abundant allelic heterogeneity (Rathmann et al 1996;Vafiadaki et al 1998;Lualdi et al 2005;Lagerstedt et al 2000;Froissart et al 2007). A pseudogene is located approximately 25 Kb telomeric to the functional gene, with homologous regions to IDS exons 2 and 3 and intron 2 and with 96% homology with intron 7, explaining the susceptibility to complex recombination events (Rathmann et al 1995;Bondeson et al 1995;Bunge et al 1998;Lualdi et al 2005).…”

Section: Introductionmentioning

confidence: 99%

Deep Genotyping of the IDS Gene in Colombian Patients with Hunter Syndrome

Galvis

González²,

Uribe

et al. 2014

JIMD Reports

View full text Add to dashboard Cite

show abstract

“…The prominent clinical features of MPS type II include a coarse face, stiff joints, hepatosplenomegaly, cardiovascular and respiratory abnormalities, short stature and mental retardation. Like other X-linked recessive genetic disorders, significant clinical heterogeneity is associated with the condition from the more common severe phenotype resulting in death by the second decade of life, to a milder disease with survival well into adulthood and little or no central nervous system involvement The mutational spectrum associated with the IDS gene is quite heterogeneous and ranges from point mutations to large-scale gene conversion or deletion (Stanislav et al, 1999, Lagerstedt et al, 2000, Michaela et al, 1996. The majority of mutations are missense and nonsense mutation, and approximately 15% of mutations are presumed to be caused by a gross deletion (Krawczak et al, 1997).…”

Section: Introductionmentioning

confidence: 99%

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: Identification of 13 novel mutations

et al. 2003

View full text Add to dashboard Cite

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.

show abstract

Analysis of a 43.6 kb deletion in a patient with Hunter syndrome (MPSII): Identification of a fusion transcript including sequences from the geneW and theIDS gene

Cited by 11 publications

References 20 publications

Mucopolysaccharidosis type II – genotype/phenotype aspects

Mucopolysaccharidosis type II – genotype/phenotype aspects

Deep Genotyping of the IDS Gene in Colombian Patients with Hunter Syndrome

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: Identification of 13 novel mutations

Contact Info

Product

Resources

About