An TRIM59‐CDK6 axis regulates growth and metastasis of lung cancer

Abstract

Lung cancer (LC) is a devastating malignancy with no effective treatments, due to its complex genomic profile. Using bioinformatics analysis and immunohistochemical of lung carcinoma tissues, we show that TRIM59 as a critical oncoprotein relating to LC proliferation and metastasis. In this study, high TRIM59 expression was significantly correlated with lymph node metastasis, distant metastasis, and tumour stage. Furthermore, up‐regulation of TRIM59 expression correlated with poorer outcomes in LC patients. Mechanistically, TRIM59 play a key role in promoting LC growth and metastasis through regulation of extracellular‐signal regulated protein kinase (ERK) signalling pathway and epithelial‐to‐mesenchymal transition (EMT)‐markers, as validated by loss‐of‐function studies. In‐depth bioinformatics analysis showed that there is preliminary evidence of co‐expression of TRIM59 and cyclin dependent kinase 6 (CDK6) in LC. Notably, CDK6 expression significantly decreased when TRIM59 was knocked down in the LC cells. In contrast, exogenous up‐regulation of TRIM59 expression also induced significant increases in the expression of CDK6. Moreover, the expression of CDK6 was also inhibited by the ERK signalling inhibitor, U0126. The results of both loss‐ and gain‐of‐function studies showed that TRIM59 could regulate the expression of CDK6. Collectively, these data provide evidence that TRIM59 is involved in lung carcinoma growth and progression possibly through the induction of CDK6 expression and EMT process by activation of ERK pathway.

Cancer-derived exosomal TRIM59 regulates macrophage NLRP3 inflammasome activation to promote lung cancer progression

“…Recently, studies indicated that exosomes contain a variety of biologically active molecules including proteins, and that exosomal proteins profiles resemble those of the parent cells [ 9 , 11 ]. We previously found that TRIM59 is closely correlated with oncogenesis and metastasis of lung cancers [ 19 ]. To elucidate whether TRIM59 was expressed in exosomes derived from lung cancer cells (H1299 and A549), we detected the expression of TRIM59 in the exosomes derived from A549 and H1299 cell lines, in which TRIM59 expression levels significantly elevated [ 19 ].…”

“…We previously found that TRIM59 is closely correlated with oncogenesis and metastasis of lung cancers [ 19 ]. To elucidate whether TRIM59 was expressed in exosomes derived from lung cancer cells (H1299 and A549), we detected the expression of TRIM59 in the exosomes derived from A549 and H1299 cell lines, in which TRIM59 expression levels significantly elevated [ 19 ]. As is shown in Fig.…”

“…Scrambled, human ABHD5 short hairpin RNA (shRNA) were obtained from Shanghai Genechem Co., Ltd. (Shanghai, China) and the following target sequences: CCGGGCAGCGTTTAAGGCCTGATTTCTCGAGAAATCAGGCCTTAAACGCTGCTTTTTG. TRIM59 shRNA was described previously [ 19 ]. To elucidate the role of TRIM59 as an E3 ligase, we generated an E3 ligase-defective TRIM59 by using the KOD-Plus-Mutagenesis kit (Toyobo, cat: SMK-101) and verified by performing DNA sequencing.…”

“…Increasing evidence showed that TRIM59 has been identified as contributing to tumor progression [ 15 – 18 ]. Our previous study has demonstrated that TRIM59 upregulated in lung cancer, is required for cancer cells survival and metastasis [ 19 ]. With the unraveling of the relationship between TRIM59 and tumors, TRIM59 is now being recognized as potential therapeutic targets for cancer.…”

TRIM39 deficiency inhibits tumor progression and autophagic flux in colorectal cancer via suppressing the activity of Rab7

“…Several members of the TRIM protein family are important regulators of CRC 45 – 48 . TRIM59 facilitates proliferation of CRC and promotes metastasis via the phosphoinositide 3-kinase/AKT pathway 49 .…”