An optimized protocol for stepwise optimization of real-time RT-PCR analysis

Abstract

Computational tool-assisted primer design for real-time reverse transcription (RT) PCR (qPCR) analysis largely ignores the sequence similarities between sequences of homologous genes in a plant genome. It can lead to false confidence in the quality of the designed primers, which sometimes results in skipping the optimization steps for qPCR. However, the optimization of qPCR parameters plays an essential role in the efficiency, specificity, and sensitivity of each gene’s primers. Here, we proposed an optimized approach to sequentially optimizing primer sequences, annealing temperatures, primer concentrations, and cDNA concentration range for each reference (and target) gene. Our approach started with a sequence-specific primer design that should be based on the single-nucleotide polymorphisms (SNPs) present in all the homologous sequences for each of the reference (and target) genes under study. By combining the efficiency calibrated and standard curve methods with the 2−ΔΔCt method, the standard cDNA concentration curve with a logarithmic scale was obtained for each primer pair for each gene. As a result, an R2 ≥ 0.9999 and the efficiency (E) = 100 ± 5% should be achieved for the best primer pair of each gene, which serve as the prerequisite for using the 2−ΔΔCt method for data analysis. We applied our newly developed approach to identify the best reference genes in different tissues and at various inflorescence developmental stages of Tripidium ravennae, an ornamental and biomass grass, and validated their utility under varying abiotic stress conditions. We also applied this approach to test the expression stability of six reference genes in soybean under biotic stress treatment with Xanthomonas axonopodis pv. glycines (Xag). Thus, these case studies demonstrated the effectiveness of our optimized protocol for qPCR analysis.

Unravelling the distinctive growth mechanism of proso millet (Panicum miliaceum L.) under salt stress: From root‐to‐leaf adaptations to molecular response

“…Three technical replicates were conducted for each target gene using the GAPDH reference gene (F: CCACCCCAGCAAGGAGACT and R: GAAATTGTGAGGGAGATGCT) as an internal control (Yue et al, 2016). The relative expression levels of target genes were calculated using the 2 −ΔΔCt comparative threshold cycle (Ct) method (Zhao et al, 2021). The expression level from the root of SS 212 under control conditions served as the calibrator sample, which was set to 1.…”

Identification of Novel Genomic Regions for Bacterial Leaf Pustule (BLP) Resistance in Soybean (Glycine max L.) via Integrating Linkage Mapping and Association Analysis

“…W82 (Xag resistant) and cv. Jack (Xag susceptible) at 0, 12, 24, 48, 72, and 120 hpi by using Cons4 and Cons6 as the internal control (or reference) genes (Tables S9 and S10) [25]. The average relative expression levels of Glyma.17G090100, Glyma.17G090200, and Glyma.17G090400 in W82 showed no significant difference from that of Jack across the six time points after Xag EB08 treatments (Figure 7A-C).…”

“…Total RNA extracted from leaf samples of soybean cvs. W82 (resistant) and Jack (susceptible) following the treatment of Xag strain EB08 at 0, 12, 24, 48, 72, and 120 hpi in Zhao et al [25] was used for cDNA synthesis and qPCR analysis of the relative expression levels of the five candidate genes, i.e., Glyma.17G090100, Glyma.17G090200, Glyma.17G090400, Glyma.17G086300, and Glyma.05G040500 in both cultivars. Three biological replicates were designed for each treatment, and three leaves of each biological replicate were infected as three technical replicates.…”

“…Three biological replicates were designed for each treatment, and three leaves of each biological replicate were infected as three technical replicates. Primer design and stepwise optimization of qPCR conditions including annealing temperatures, primer concentrations, and cDNA concentration ranges were conducted as described in Zhao et al [25] so that R 2 ≥ 0.99 and E = 100 ± 5% were achieved for the best primer pair for each gene. The relative expression levels were calculated using Cons4 and Cons6 as the two reference genes [25] and the Pfaffl method [55].…”

RT-qPCR Detection of SARS-CoV-2: No Need for a Dedicated Reverse Transcription Step

“…Combined with the subsequent discovery of Taq polymerase [3] and the theory [4] and practical realisation of the polymerase chain reaction (PCR) [5,6], reverse transcription (RT)-PCR was quickly adopted as a powerful method for the analysis of RNA [7,8]. Whilst early protocols included 60 min incubation times for the RT step [9], most contemporary protocols tend to be more rapid at between 15 [10] and 30 min [11], although markedly longer RT polymerisation times continue to be used [12]. This is generally not a problem for research applications but becomes an issue when RT-PCR is used in the context of rapid diagnostic testing.…”