An on-demand, drop-on-drop method for studying enzyme catalysis by serial crystallography

Abstract

Serial femtosecond crystallography has opened up many new opportunities in structural biology. In recent years, several approaches employing light-inducible systems have emerged to enable time-resolved experiments that reveal protein dynamics at high atomic and temporal resolutions. However, very few enzymes are light-dependent, whereas macromolecules requiring ligand diffusion into an active site are ubiquitous. In this work we present a drop-on-drop sample delivery system that enables the study of enzyme-catalyzed reactions in microcrystal slurries. The system delivers ligand solutions in bursts of multiple picoliter-sized drops on top of a larger crystal-containing drop inducing turbulent mixing and transports the mixture to the X-ray interaction region with temporal resolution. We demonstrate mixing using fluorescent dyes, numerical simulations and time-resolved serial femtosecond crystallography, which show rapid ligand diffusion through microdroplets. The drop-on-drop method has the potential to be widely applicable to serial crystallography studies, particularly of enzyme reactions with small molecule substrates.

Combination of an inject-and-transfer system for serial femtosecond crystallography

“…Therefore, it is not suitable because the consumption of crystal samples is overwhelming when applied in PAL-XFEL with a low repetition rate. Then, the mix-and-diffuse [36] or drop-on-drop [37] method using the conveyor belt approach and the LAMA [38] approach were also considered suitable systems for our research goals. However, this instrument may require considerable effort for precise alignment to pass the XFEL to the sample, so it is difficult to apply when obtaining very short beamtime.…”

“…In the mix-and-diffuse [36] or drop-on-drop [37] method, crystal samples are placed on the polyimide tape by an injector, and these crystals are delivered to the X-ray interaction point by driving the conveyor belt. This method enables liquid-based time-resolving studies for various time delays by controlling the mixing speed and speed of the conveyor belt [36, 37]. In the liquid application method for time-resolved analyses (LAMA) [38] approach, the crystals are injected into a fixed-target chip, and these crystals are delivered to the X-ray interaction point by the translation stage motion.…”

“…In contrast, a hybrid-type sample delivery method that combines injection and motion was developed. In the mix-and-diffuse [36] or drop-on-drop [37] method, crystal samples are placed on the polyimide tape by an injector, and these crystals are delivered to the X-ray interaction point by driving the conveyor belt. This method enables liquid-based time-resolving studies for various time delays by controlling the mixing speed and speed of the conveyor belt [36, 37].…”

Penicillanic Acid Sulfones Inactivate the Extended-Spectrum β-Lactamase CTX-M-15 through Formation of a Serine-Lysine Cross-Link: an Alternative Mechanism of β-Lactamase Inhibition

“…CTX-M-15 G238C/G239_Y240insA was generated using popinF-CTX-M-15 G238C as a template with the primer pair 5′- GATAAAACCGGCAGCTGTGGCGCGTATGGCACCACCAAC -3′ and 5′- GTTGGTGGTGCCATACGCGCCACAGCTGCCGGTTTTATC -3′. All mutant enzymes were purified using the same procedure as for the native enzyme and crystallized using seeds generated from native CTX-M-15 crystals ( 10 ), as previously described ( 48 ).…”

Serial X-ray Crystallography

“…Additionally, other sample delivery methods, such as microfluidics [49][50][51], capillaries [52,53], and conveyer belts [54], have been developed. Moreover, recently the "hit-andreturn" (HARE) [55] and drop-on-drop methods [56] were developed for time-resolved SX experiments and molecular movies have been successfully visualized. Although there are differences depending on the sample delivery device obtained by the facility or beamline, a pool of sample delivery systems that researchers can select from according to the characteristics of the crystal sample is provided.…”