An iron deficiency-specific cDNA from barley roots having two homologous cysteine-rich MT domains

Plant metallothioneins

“…Moreover, slight decreases in transcript abundance were observed in response to highly elevated copper concentrations (de Miranda et al, 1990;Kawashima et al, 1991). Transcripts encoded by the ids-I gene from barley were detected in roots grown under conditions of iron deficiency but not in roots supplemented with available iron (Okumura et al, 1991). The abundance of PsMT transcripts in pea roots also declines following supplementation with iron chelates (N. J. Robinson, unpublished work).…”

“…Genes that encode proteins with (some) sequence similarity to metallothioneins have been isolated from several plant species (Evans et Takahashi, 1991;Okumura et al, 1991;de Framond, 1991;Robinson et al, 1992). All of these genes encode predicted proteins with two Cys-rich domains containing Cys-Xaa-Cys motifs (where Xaa is an amino acid other than Cys).…”

“…Occurrence and Isolation of plant genes with similarity to metallothionein genes Several metallothionein-like plant genes have been isolated (by serendipity) via differential screening of cDNA libraries for rootabundant sequences de Framond, 1991), sequences repressed by elevated copper (de Miranda et al, 1990) and sequences induced in response to depleted iron (Okumura et al, 1991). Sequences preferentially expressed in roots rather than other organs were isolated from cDNA libraries prepared from poly(A)+ RNA from roots of garden pea (Pisum sativum) and maize (Zea mays) de Framond, 1991).…”

“…Partial sequences of two further members of the pea gene family, PsMTB and PsMTc, have been obtained following PCR-mediated cloning . A related cDNA from barley, ids-J, was identified in a library prepared from root poly(A)+ RNA isolated from plants grown under conditions of iron deficiency, following differential screening with probes prepared from poly(A)+ RNA from iron-deficient and iron-sufficient roots (Okumura et al, 1991). A soyabean (Glycine max) sequence was isolated from a cDNA library following hybridization to a 21-mer oligonucleotide (5' ATGGACCCCAACTGCTCCTGC 3') that corresponds to a conserved region found at the N-terminus of mammalian metallothionein genes (Kawashima et al, 1991 , alfalfa (Medicago sativum) and Arabidopsis thaliana (Takahashi, 1991) and to reveal cognates in several other higher plant species by Southern analysis.…”

Generation and Field Trials of Transgenic Rice Tolerant to Iron Deficiency

“…We cloned iron-deficiencyspecific (IDS) genes specifically expressed in Fe-deficient barley roots [39,49,50] homologous to 2-oxoglutarate-dependent dioxygenases, suggesting their possible involvement in the hydroxylation of MAs. By interspecies correlation between the expression of IDS2-IDS3 and the capacity to secrete hydroxylated MAs, we deduced that IDS3 is the enzyme that hydroxylates the C-2' positions of DMA and epiHDMA, while IDS2 hydroxylates the C-3 positions of DMA and MA ( Fig.…”