An Intron Element Modulating 5′ Splice Site Selection in the hnRNP A1 Pre-mRNA Interacts with hnRNP A1

Abstract

The hnRNP A1 pre-mRNA is alternatively spliced to yield the A1 and A1b mRNAs, which encode proteins differing in their ability to modulate 5 splice site selection. Sequencing a genomic portion of the murine A1 gene revealed that the intron separating exon 7 and the alternative exon 7B is highly conserved between mouse and human. In vitro splicing assays indicate that a conserved element (CE1) from the central portion of the intron shifts selection toward the distal donor site when positioned in between the 5 splice sites of exon 7 and 7B. In vivo, the CE1 element promotes exon 7B skipping. A 17-nucleotide sequence within CE1 (CE1a) is sufficient to activate the distal 5 splice site. RNase T 1 protection/immunoprecipitation assays indicate that hnRNP A1 binds to CE1a, which contains the sequence UAGAGU, a close match to the reported optimal A1 binding site, UAGGGU. Replacing CE1a by different oligonucleotides carrying the sequence UAGAGU or UAGGGU maintains the preference for the distal 5 splice site. In contrast, mutations in the AUGAGU sequence activate the proximal 5 splice site. In support of a direct role of the A1-CE1 interaction in 5-splice-site selection, we observed that the amplitude of the shift correlates with the efficiency of A1 binding. Whereas addition of SR proteins abrogates the effect of CE1, the presence of CE1 does not modify U1 snRNP binding to competing 5 splice sites, as judged by oligonucleotide-targeted RNase H protection assays. Our results suggest that hnRNP A1 modulates splice site selection on its own pre-mRNA without changing the binding of U1 snRNP to competing 5 splice sites.Most mammalian pre-mRNAs contain introns that must be removed through RNA splicing. Pre-mRNA splicing takes place in the spliceosome, which is a large, multicomponent complex that includes a set of the four snRNPs, U1, U2, U4/ U6, and U5, and a number of non-snRNP proteins (reviewed in references 28, 29, and 46). Multiple snRNP-snRNP and snRNP-pre-mRNA interactions are crucial in specifying the efficiency and the precision of splicing (reviewed in references 49 and 54). One challenging aspect of RNA splicing is to understand how appropriate pairs of 5Ј and 3Ј splice sites are selected in pre-mRNAs containing multiple introns. Alternative splicing brings another dimension to the issue of splice site selection as it involves modulating the pairing of splices sites during development and differentiation.The selection of splice sites is determined by several parameters including the proximity and strength of splicing signals (reviewed in reference 5). Although mutations in splicing signals often affect splice site selection, the fit of a splice site to consensus sequences is not sufficient to predict splice site utilization. Sequences lying outside splice sites appear to provide a context that influences splice site recognition. This notion of context has remained ill defined, but recent progress has revealed that the recognition of a weak 3Ј splice site is improved by a downstream 5Ј splice site through exon-brid...

An intronic element contributes to splicing repression in spinal muscular atrophy

“…and J.L.M., unpublished data), suggesting that the mechanism of exon 7 exclusion involves a step subsequent to early spliceosome assembly. This finding is consistent with studies with hnRNP A1 premRNA (38,12) and with other studies proposing a similar mechanism for PTB-dependent exon suppression (39). Thus, looping out of RNA between occupied hnRNP1 A1 binding sites likely does not affect early snRNP-RNA interactions but rather subsequent steps, such as cross-talk between U1 and U2 snRNPs.…”

Altered patterns of expression of members of the heterogeneous nuclear ribonucleoprotein (hnRNP) family in lung cancer

“…More importantly, the stoichiometry for the hnRNP proteins coming from the same gene (A2/B1, C1/C2) varies from cell line to cell line, indicating that there may also exist a regulation in the splicing of the hnRNP gene itself that could be thus relevant to its role in the mRNA processing of other genes. This complex scenario may also apply to hnRNP A1, for which it has been shown that mRNA splicing can be regulated by its own protein [42]. Therefore, to understand the role of hnRNP proteins in cancer, we need to determine, not only the expression of every gene but also the relative proportion of its diverse alternative splicing forms.…”

Structural basis of G-tract recognition and encaging by hnRNP F quasi-RRMs

“…HeLa nuclear extract 62 was then added to the mixture under standard splicing conditions 63 and incubated for 2 h at 30°C. Reverse transcription was carried out using the bc2b primer (CGCTCTAGAACTAGTGGATC) and Omniscript (Qiagen).…”