An FGFR3 Autocrine Loop Sustains Acquired Resistance to Trastuzumab in Gastric Cancer Patients

Piro, Geny; Carbone, Carmine; Cataldo, Ivana; Nicolantonio, Federica Di; Giacopuzzi, Simone; Aprile, Giuseppe; Simionato, Francesca; Boschi, Federico; Zanotto, Marco; Mina, Maria Mihaela; Santoro, Raffaela; Merz, Valeria; Sbarbati, Andrea; Manzoni, Giovanni De; Scarpa, Aldo; Tortora, Giampaolo; Melisi, Davide

doi:10.1158/1078-0432.ccr-16-0178

Cited by 67 publications

(61 citation statements)

References 36 publications

(37 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In another study, combined inhibition of EGFR and FGFR reduced tumor stroma and delayed recurrence of FGFR-driven transgenic mammary tumors following FGFR inhibitor therapy (35). FGFR2 and FGFR3 have been implicated in resistance to EGFR inhibition in NSCLC (36) and trastuzumab resistance in gastric cancer (37). Further, FGFR signaling was shown to promote resistance to the KIT/PDGFR inhibitor imatinib in gastrointestinal stromal tumors through reactivation of MAPK signaling (38).…”

Section: Discussionmentioning

confidence: 99%

HER2-Overexpressing Breast Cancers Amplify FGFR Signaling upon Acquisition of Resistance to Dual Therapeutic Blockade of HER2

Hanker

Garrett

Estrada

et al. 2017

Clinical Cancer Research

View full text Add to dashboard Cite

Purpose Dual blockade of HER2 with trastuzumab and lapatinib or pertuzumab has been shown to be superior to single-agent trastuzumab. However, a significant fraction of HER2-overexpressing (HER2+) breast cancers escape from these drug combinations. In this study, we sought to discover the mechanisms of acquired resistance to the combination of lapatinib + trastuzumab. Experimental Design HER2+ BT474 xenografts were treated with lapatinib + trastuzumab long-term until resistance developed. Potential mechanisms of acquired resistance were evaluated in lapatinib + trastuzumab-resistant (LTR) tumors by targeted capture next-generation sequencing. In vitro experiments were performed to corroborate these findings and a novel drug combination was tested against LTR xenografts. Gene expression and copy number analyses were performed to corroborate our findings in clinical samples. Results LTR tumors exhibited an increase in FGF3/4/19 copy number, together with an increase in FGFR phosphorylation, marked stromal changes in the tumor microenvironment, and reduced tumor uptake of lapatinib. Stimulation of BT474 cells with FGF4 promoted resistance to lapatinib + trastuzumab in vitro. Treatment with FGFR tyrosine kinase inhibitors reversed these changes and overcame resistance to lapatinib + trastuzumab. High expression of FGFR1 correlated with a statistically shorter progression-free survival in patients with HER2+ early breast cancer treated with adjuvant trastuzumab. Finally, FGFR1 and/or FGF3 gene amplification correlated with a lower pathological complete response in patients with HER2+ early breast cancer treated with neoadjuvant anti-HER2 therapy. Conclusions Amplification of FGFR signaling promotes resistance to HER2 inhibition, which can be diminished by the combination of HER2 and FGFR inhibitors.

show abstract

Section: Discussionmentioning

confidence: 99%

HER2-Overexpressing Breast Cancers Amplify FGFR Signaling upon Acquisition of Resistance to Dual Therapeutic Blockade of HER2

Hanker

Garrett

Estrada

et al. 2017

Clinical Cancer Research

View full text Add to dashboard Cite

show abstract

“…Moreover, the mechanisms of acquired resistance to anti‐HER2 treatment may be heterogeneous by themselves—being multiple and potentially concomitant within the same individual. Obviously, there must be other mechanisms of importance requiring further clinical and possibly basic research, as recently shown for FGFR3 activation . Therefore, a comprehensive assessment of putative resistance mechanisms including HER2 loss are still to be considered an unmet clinical need in this research field.…”

Section: Discussionmentioning

confidence: 99%

HER2 loss in HER2‐positive gastric or gastroesophageal cancer after trastuzumab therapy: Implication for further clinical research

Pietrantonio

Caporale

Morano

et al. 2016

Intl Journal of Cancer

100

View full text Add to dashboard Cite

Mechanisms of acquired resistance to trastuzumab-based treatment in gastric cancer are largely unknown. In this study, we analyzed 22 pairs of tumor samples taken at baseline and post-progression in patients receiving chemotherapy and trastuzumab for advanced HER2-positive [immunohistochemistry (IHC) 3+ or 2+ with in-situ hybridization (ISH) amplification] gastric or gastroesophageal cancers. Strict clinical criteria for defining acquired trastuzumab resistance were adopted. Loss of HER2 positivity and loss of HER2 over-expression were defined as post-trastuzumab IHC score <3+ and absence of ISH amplification, and IHC "downscoring" from 2+/3+ to 0/1+, respectively. HER2 IHC was always performed, while ISH was missing in 3 post-progression samples. Patients with initial HER2 IHC score 3+ and 2+ were 14 (64%) and 8 (36%), respectively. Loss of HER2 positivity and HER2 over-expression was observed in 32 and 32% samples, respectively. The chance of HER2 loss was not associated with any of the baseline clinicopathological variables. The only exception was in patients with initial IHC score 2+ versus 3+, for both endpoints of HER2 positivity (80 vs. 14%; p = 0.008) and HER2 over-expression (63 vs. 14%; p = 0.025). As already shown in breast cancer, loss of HER2 may be observed also in gastric cancers patients treated with trastuzumab-based chemotherapy in the clinical practice. This phenomenon may be one of the biological reasons explaining the failure of anti-HER2 second-line strategies in initially HER2-positive disease.

show abstract

“…Clone ID Sequence MAP3K3 TEVH-1081756 GGACATTCGTGATTTCCGGA MAP3K3 TEVH-1148898 CCTTGTGGTGCACAGACACG MAP3K3 TEVH-1216040 ACAGACACGTGGTAGCGCCG TELG1012 Non targeting control GGAGCGCACCATCTTCTTCA SK-4105, Vector Lab, Burlingame, CA, USA) as a chromogen, as previously described in (33). For antigen retrieval, the sections were subjected to pressure cooker heating in antigen retrieval buffer (either citrate pH 6.0, ab93678 or Tris-EDTA pH 9.0, ab93684, Abcam, Cambridge, UK).…”

Section: Genementioning

confidence: 99%

MEKK3 Sustains EMT and Stemness in Pancreatic Cancer by Regulating YAP and TAZ Transcriptional Activity

2018

View full text Add to dashboard Cite

Abstract. Background Pancreatic cancer remains one of the most lethal and poorly understood human malignancies (1, 2). It has the lowest 5-year relative survival rate among solid tumors at 8% (3), and is projected to become the second leading cause of cancer-related death by 2030 in Western countries (4). Poor prognosis in pancreatic cancer is attributed to its early metastatic behavior, aggressive clinical course, and limited efficacy of chemotherapeutic treatments (5, 6).Epithelial-to-mesenchymal transition (EMT) is a wellcoordinated process triggered by many signaling pathways during embryonic development. However, its aberrant activation in cancer development has been associated with cancer stem cell properties, self-renewal capabilities, resistance to conventional therapies, and endow cancer cells with the migratory and invasive capabilities associated with metastatic competence (7).In the last decade, we contributed to this field by demonstrating that different paracrine inflammatory signals -including Interleukin-1 (IL-1) (8) -could induce EMT and, in turn, metastasis and treatment resistance in colorectal (9, 10) and pancreatic cancer (11). During the immune and inflammatory responses, the IL-1-induced TRAF-6 signaling leads to the activation of NF-ĸB (12) -a key transcriptional factor that orchestrates expression of many genes involved in inflammation, oncogenesis, and apoptosis (13, 14) -through two parallel signaling pathways depending upon the activation of two Mitogen-activated kinase kinase kinases (MAP3Ks), the TGF-β-activated kinase 1 (TAK1; MAP3K7) (15,16), and the MAP3K3, or MEKK3 (17,18).MEKK3 is a serine/threonine kinase belonging to the MEKK/STE11 subgroup of the MAP3K family that is constitutively expressed in several types of tissues. A pivotal role for MEKK3 has been demonstrated in orchestrating cellular processes such as proliferation, cell cycle progression, differentiation, migration, apoptosis and inflammatory response (17, 19), through the integration of different signaling pathways, such as TNFα (20), IL-1 (17) and TLR4 (21).The transcriptional regulators yes-associated protein (YAP) and transcriptional coactivator with PDZ-binding motif (TAZ) are emerging as key players in cancer initiation and progression.

show abstract

An FGFR3 Autocrine Loop Sustains Acquired Resistance to Trastuzumab in Gastric Cancer Patients

Abstract: This study identified the FGFR3/AKT axis as an escape pathway responsible for trastuzumab resistance in gastric cancer, thus indicating the inhibition of FGFR3 as a potential strategy to modulate this resistance. Clin Cancer Res; 22(24); 6164-75. ©2016 AACR.

Cited by 67 publications

References 36 publications

HER2-Overexpressing Breast Cancers Amplify FGFR Signaling upon Acquisition of Resistance to Dual Therapeutic Blockade of HER2

HER2-Overexpressing Breast Cancers Amplify FGFR Signaling upon Acquisition of Resistance to Dual Therapeutic Blockade of HER2

HER2 loss in HER2‐positive gastric or gastroesophageal cancer after trastuzumab therapy: Implication for further clinical research

MEKK3 Sustains EMT and Stemness in Pancreatic Cancer by Regulating YAP and TAZ Transcriptional Activity

Contact Info

Product

Resources

About