An experimental demonstration that early-life competitive disadvantage accelerates telomere loss

Abstract

Adverse experiences in early life can exert powerful delayed effects on adult survival and health. Telomere attrition is a potentially important mechanism in such effects. One source of early-life adversity is the stress caused by competitive disadvantage. Although previous avian experiments suggest that competitive disadvantage may accelerate telomere attrition, they do not clearly isolate the effects of competitive disadvantage from other sources of variation. Here, we present data from an experiment in European starlings (Sturnus vulgaris) that used cross-fostering to expose siblings to divergent early experience. Birds were assigned either to competitive advantage (being larger than their brood competitors) or competitive disadvantage (being smaller than their brood competitors) between days 3 and 12 post-hatching. Disadvantage did not affect weight gain, but it increased telomere attrition, leading to shorter telomere length in disadvantaged birds by day 12. There were no effects of disadvantage on oxidative damage as measured by plasma lipid peroxidation. We thus found strong evidence that early-life competitive disadvantage can accelerate telomere loss. This could lead to faster age-related deterioration and poorer health in later life.

Brood size moderates associations between relative size, telomere length, and immune development in European starling nestlings

“…The key predictors were brood size, relative weight on day 16, and their interaction. As covariates, we included sex and, because telomere attrition has been previously observed to be faster in individuals with longer telomeres even after controlling for regression to the mean (Nettle et al., 2015; Verhulst et al., 2013), telomere length on day 4. Results were unchanged whether or not these covariates (whose effects were not significant) were included in the model.…”

“…These primers were developed in the zebra finch (Criscuolo et al., 2009) but have been used in other passerine species including the starling (Nettle et al., 2013, 2015). Telomere primers were as follows: Tel1b (5′‐CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT‐3′) and Tel2b (5′‐GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT‐3′).…”

“…A possible explanation for this is that these individuals carry a mutation in the GAPDH gene which inhibits its amplification. We have encountered the same phenomenon in previous studies of this starling population (Nettle et al., 2013, 2015). …”

“…We also calculated average daily growth rate, that is, the difference between day 16 weight and day 4 weight, divided by 12, but this was strongly correlated with day 16 weight ( r 153  = .72, p  <   .01), produced the same pattern of results, and hence is not considered further. Our previous findings suggest that what is important in terms of the costs of competition is size relative to other nestlings in the same brood (Nettle et al., 2015). We thus calculated relative weight measures consisting of z ‐scores for each bird within its nest (i.e., [nestling weight − mean weight of nestlings in the brood] / SD of weights in the brood).…”

“…In the large broods, we found a correlation between position in the within‐brood size hierarchy and the rate of telomere change: The relatively larger chicks showed less telomere loss during development (Nettle, Monaghan, Boner, Gillespie, & Bateson, 2013). We were able to confirm that it is position in the size hierarchy of the brood (i.e., relative rather than absolute size) that matters in a subsequent experiment (Nettle et al., 2015) where we manipulated this directly (see also Stier, Massemin, Zahn, Tissier, & Criscuolo, 2015). For immune capacity, likewise, correlational studies across a number of species have found that larger size goes with higher, rather than lower, immune capacity (Fair, Hansen, & Ricklefs, 1999; Hoi‐Leitner, Romero‐Pujante, Hoi, & Pavlova, 2001; Lochmiller, Vestey, & Boren, 1993; Saino, Calza, & Moller, 1997; Snoeijs, Pinxten, & Eens, 2005; Tella, Bortolotti, Forero, & Dawson, 2000).…”