An efficient sorghum transformation system using embryogenic calli derived from mature seeds

Abstract

Significant progress has been made on sorghum transformation in the last decades; however, the transformation process has been constrained by the availability of immature embryos because most of the researchers have utilized immature embryos as favorable explants. Although immature embryos have been proven to be optimal for tissue culture and transformation, isolation of immature embryos is time-consuming, labor-intensive, and limited by warm weather. In this study, we developed an efficient genetic transformation system using mature seeds as explants. The nptII and gus gene, used as the selective marker and report gene respectively, have been co-transformed by particle bombardment. After optimization of tissue culture, the G418 concentration, and transgenic, the average transformation frequency at 13.33% was achieved routinely. The transgenic events and transgene copy numbers were determined by PCR and RT-PCR, respectively. The geneticin selection and GUS staining on T1 seedlings confirmed that the transgenic plants were heritable. Our results demonstrated that the efficient sorghum transformation system has been established using mature seeds as explants. This transformation system will promote sorghum research on genetic engineering and genome editing without seasonal weather conditions restriction and explant resources restriction.

Manifestation of agronomically valuable traits in the progeny of a sorghum mutant carrying the genetic construct for RNA silencing of the γ-kafirin gene

“…Analysis of the number of copies of RNAi genetic construct. To clarify the copy number of the genetic construct for silencing of gKAF1 in T 3 and T 4 plants, quantitative PCR analysis (qPCR) was carried out with primers to the nos-promoter, while the sorghum APRT gene, which was previously used in experiments to identify the number of copies of transgenes in different plant species, including sorghum (Casu et al, 2012; Wang et al, 2021), was used as a reference control. In addition, the copy number of the introduced genetic construct was also calculated using DNA from the plant No.…”

“…qPCR analysis. The copy number of the genetic construct for RNAi was determined using quantitative PCR by amplifying a 119 bp fragment of sorghum anthranilate phosphoribosyl transferase gene (APRT, Sobic.002G303300), selected as a reference gene (Casu et al, 2012;Wang et al, 2021), and a 201 bp fragment of the nospromoter. The reaction mixture contained 2 μl of genomic DNA (10 ng/μl), 10 μl of a readymade amplification reaction mixture containing the intercalating dye SYBR Green (2X HS-qSYBR-blue, Biolabmix, Russia) and 0.4 pmol of each primer; the total volume of the reaction mixture was 20 µl; the number of replications was three.…”

“…qPCR was performed using a LightCycler 96 real-time PCR instrument (Roche, Switzerland). The pri mers for the APRT gene were as follows (F (5′→3′)): tgacacattccc aacctcaa and R (5′→3′): atctctctccctgagtggca) (Wang et al, 2021); primers for the nos-promoter are described above. The concentration of genomic DNA and primers was determined using a Nanodrop One C UV spectrophotometer (Thermo Fisher Scientific, USA) by measuring absorbance at wavelengths of 230/260/280 nm.…”

New methods for sorghum transformation in temperate climates

“…Biotechnological approaches have been very successful in other cereals, especially maize, but sorghum is very recalcitrant to genetic transformation ( Williams et al 2004 ; O’Kennedy et al 2006 ; Raghuwanshi and Birch 2010 ). Sorghum transformation is considered to mainly be possible in warmer climates since the growth conditions for the plants serving as donors for the explants for transformation, the immature embryos, are crucial for success ( Zhao et al 2000 ; Belide et al 2017 ; Wang et al 2021 ). Climate has been identified as one of the main conditions influencing transformation efficiency, and Belide et al (2017) suggested an approach to use differentiating callus sourced from sorghum grown in summer months and maintained through winter for year-round transformation.…”