An efficient and multiple target transgenic RNAi technique with low toxicity in Drosophila

Abstract

Being relatively simple and practical, Drosophila transgenic RNAi is the technique of top priority choice to quickly study genes with pleiotropic functions. However, drawbacks have emerged over time, such as high level of false positive and negative results. To overcome these shortcomings and increase efficiency, specificity and versatility, we develop a next generation transgenic RNAi system. With this system, the leaky expression of the basal promoter is significantly reduced, as well as the heterozygous ratio of transgenic RNAi flies. In addition, it has been first achieved to precisely and efficiently modulate highly expressed genes. Furthermore, we increase versatility which can simultaneously knock down multiple genes in one step. A case illustration is provided of how this system can be used to study the synthetic developmental effect of histone acetyltransferases. Finally, we have generated a collection of transgenic RNAi lines for those genes that are highly homologous to human disease genes.

Role of Hakai in m6A modification pathway in Drosophila

“…To study Hakai function, we generated a sgRNA and constructed or obtained three non-overlapping shRNA lines ( Fig. 2A) 55,56 . By crossing the U6:3-Hakai sgRNA with nanos-Cas9 57 , we generated a series of Hakai mutants with various small deletions and/or insertions.…”

“…Hakai shRNAs were made based on the new pNP vector by Tsinghua Fly Center 56 . TH14422.S with target sequence "GAGCTCGACAAGGACGGCGAA" was inserted at attP2 site and TH14423.S with target sequence "CGGCCGCATGATACCCTGCAA" was inserted at attP40 site.…”

Large-scale transgenicDrosophilaresource collections for loss- and gain-of-function studies

“…Additional TRiP shRNA stocks are also available from the National Institute of Genetics, Japan (https://shigen.nig.ac.jp/fly/nigfly/) and the Tsinghua Fly Center, China (http://fly.redbux.cn/). Notably, the latter collection includes 1093 shRNA lines made with the new pNP vector, which functions in both in soma and germline with significantly reduced basal hairpin expression (Qiao et al 2018).…”

“…HuDis-TRiP stocks were made in the VALIUM20 vector. Typically, ~15% of shRNA stocks made in VALIUM20 do not homozygose due to leaky expression of the transgene (Qiao et al 2018). Therefore, we also generated a resource of 1000 lines targeting human disease orthologs using the pNP vector (Qiao et al 2018).…”

“…Typically, ~15% of shRNA stocks made in VALIUM20 do not homozygose due to leaky expression of the transgene (Qiao et al 2018). Therefore, we also generated a resource of 1000 lines targeting human disease orthologs using the pNP vector (Qiao et al 2018). The pNP stocks have reduced basal shRNA expression and RNAi specificity compared to VALIUM series stocks and augment the gene coverage of the collection.…”