Amplification of IgG VH and VL (Fab) from single human plasma cells and B cells

Coronella, Julia; Telleman, Pieter; Truong, Tran; Ylera, Francisco; Junghans, Richard P.

doi:10.1093/nar/28.20.e85

Cited by 40 publications

(23 citation statements)

References 13 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For the patient NOS251, the primer combinations were Hc [seven variable region 5¢ primers, four constant region 3¢ primers (total 28 combinations)], Lj [four variable region 5¢ primers, one constant region 3¢ primer (total four combinations)] and Lk [nine variable region 5¢ primers, one constant region 3¢ primer (total nine combinations)]. The primer sequences were as previously described [8]. PCR was achieved with Gold Taq polymerase (Applied Biosystems, Foster City, CA, USA) under conditions previously described [6].…”

Section: Rt-pcrmentioning

confidence: 99%

“…Gel of RT-PCR products of NOS251 using seven 5¢ VH primer sets with separate 3¢ primers for IgG1, IgG2, IgG3, and IgG4. IgG1 PCR products (lanes 1-7); IgG2 (lanes [8][9][10][11][12][13][14], IgG3 (lanes 15-21), IgG4 (lanes [22][23][24][25][26][27][28]. IgG1 was dominant in the NOS251 tumor GACAGCAGCAC----TGTGTTATTCGGCGAAGG NOS214L12 GACAGCAGCAC----TGTGGTATTCGGCGAAGG NOS214L14 GACAGCAGCACC-TATGTGGTAATCGGCGGAGG NOS214L15 GACAGCAGCACTGCATGTGGTATTCGGCGGAGG IGLV3-1*01J3*01 GACAGCAGCACTGCA IGLV3-1*01 Fig.…”

Section: Germline Gene Usagementioning

confidence: 99%

See 1 more Smart Citation

Focused antibody response in plasma cell-infiltrated non-medullary (NOS) breast cancers

Wang

Ylera

Boston

et al. 2007

Breast Cancer Res Treat

View full text Add to dashboard Cite

Breast tumors with prominent plasma cell (PC) infiltrates often have a more favorable natural course that may plausibly be mediated by anti-tumor activity of the elicited antibodies. These breast tumor-associated PCs are typically IgG dominant in contrast to normal breast PCs, which are mainly IgA. It is our hypothesis that this PC infiltration represents a host immune response that is driven by one or more tumor antigens. Previously, we and others showed that medullary carcinoma (MC) had a focused repertoire and features suggestive of a protein antigen driven response. Infrequently, non-MC, not otherwise specified (NOS) breast tumors may exhibit heavy PC infiltrations, also of IgG isotype. In this first characterization of this favorable prognosis NOS subgroup, IgG heavy chain (Hc) and light chain (Lc) variable (V) regions from three PC-infiltrated NOS tumors were randomly cloned and sequenced. We found biased (V) gene usage by the infiltrating PCs and somatic hypermutation in the rearranged Ig Hc and Lc V regions that were compatible with antigenic selection of the progenitor B cells. The antibody response of NOS infiltrated breast cancer is repertoire-focused, with 13-68% of isolates being clonally reiterated in the samples. Each NOS patient used distinct Hc V-D-J and Lc V-J rearrangements, with her own immune response "footprint," but the overall pattern of gene usage followed that typical of exogenous antigen-induced immune responses. The data are consistent with the hypothesis that PC infiltrates infrequently arising in NOS tumors, as previously inferred for MC, are in response to one or more breast cancer-associated protein tumor antigens.

show abstract

Section: Rt-pcrmentioning

confidence: 99%

Section: Germline Gene Usagementioning

confidence: 99%

Focused antibody response in plasma cell-infiltrated non-medullary (NOS) breast cancers

Wang

Ylera

Boston

et al. 2007

Breast Cancer Res Treat

View full text Add to dashboard Cite

show abstract

“…Patient 3 TIL-B. One library was made with an IgG1-specific C region primer (CG1z), and the second library was constructed using a pan-IgG C region primer (C H IgG), as previously described (35). PCR products were cloned as described for patient 1.…”

Section: Igg H Chain Library Preparation For Repertoire Analysismentioning

confidence: 99%

Antigen-Driven Oligoclonal Expansion of Tumor-Infiltrating B Cells in Infiltrating Ductal Carcinoma of the Breast

Coronella

Spier

Welch

et al. 2002

The Journal of Immunology

154

124

View full text Add to dashboard Cite

The objective of this study was to determine whether tumor-infiltrating B cells (TIL-B) of infiltrating ductal carcinoma (IDC) of the breast represent a tumor-specific humoral immune response. Immunohistochemical analysis of three Her-2/neu-negative IDC tumors from geriatric patients showed that TIL-B cluster in structures similar to germinal centers containing CD20+ B lymphocyte and CD3+ T lymphocyte zones with interdigitating CD21+ follicular dendritic cells, suggesting an in situ immune response. A total of 29, 31, and 58 IgG1 H chain clones was sequenced from the three IDC tumors, respectively. Intratumoral oligoclonal expansion of TIL-B was demonstrated by a preponderance (45–68%) of clonal B cells. In contrast, only 7% of tumor-draining lymph node and 0% of healthy donor PBL IgG H chains were clonal, consistent with the larger repertoires of node and peripheral populations. Patterns and levels of TIL-B IgG H chain somatic hypermutation suggested affinity maturation in intratumoral germinal centers. To examine the specificity of TIL-B Ig, a phage-displayed Fab library was generated from the TIL-B of one IDC tumor. Panning with an allogeneic breast cancer cell line enriched Fab binding to breast cancer cells, but not nonmalignant cell lines tested. However, panning with autologous tumor tissue lysate increased binding of Fab to both tumor tissue lysate and healthy breast tissue lysate. These data suggest an in situ Ag-driven oligoclonal B cell response to a variety of tumor- and breast-associated Ags.

show abstract

“…Currently, for the isolation of high affinity mAbs by somatic hypermutation and affinity maturation technique, the direct molecular cloning of identical pairs of antibody light chain lambda variable (VLλ), heavy chain (IgH) variable (VH) and light chain kappa variable (VLκ) genes from single antigen-specific plasma/plasmablast cells (ASPCs) with the help of polymerase chain reaction (PCR) is an alternative technique being used for the development of mAb from immunized animals [37][38][39][40][41][42] [43][44][45][46][47][48][49][50][51][52][53].…”

Section: Single B Cell Amplificationmentioning

confidence: 99%

Advances in Monoclonal Antibodies Production and Cancer Therapy

Saeed¹

2016

MOJI

View full text Add to dashboard Cite

Monoclonal antibodies are highly specific class of antibodies which are produced by identical hybridoma cells. These antibodies are developed by various advanced and powerful technologies being used in the areas of cell biology, biochemistry, biotechnology, immunology and medical sciences. The techniques involved hybridoma technology, phage display technology, single B-cell amplification by polymerase chain reaction (PCR) and many other modified methods. The advancement in antibody therapeutics is an essential area of growth in the pharmaceutical manufacturing and more than 30 monoclonal antibodies have been approved on the US and Europe markets. Regardless of these advancements, certain significant target antigens remain intractable to therapeutic antibodies due to complexity of the target molecules. The present review describes recent advances in monoclonal antibody production and cancer therapy for better understanding the therapeutic efficacy.

show abstract

Amplification of IgG VH and VL (Fab) from single human plasma cells and B cells

Cited by 40 publications

References 13 publications

Focused antibody response in plasma cell-infiltrated non-medullary (NOS) breast cancers

Focused antibody response in plasma cell-infiltrated non-medullary (NOS) breast cancers

Antigen-Driven Oligoclonal Expansion of Tumor-Infiltrating B Cells in Infiltrating Ductal Carcinoma of the Breast

Advances in Monoclonal Antibodies Production and Cancer Therapy

Contact Info

Product

Resources

About