Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella

Rahn, Kris; Grandis, Stephanie A. De; Clarke, Robert C.; McEwen, Scott A.; Galán, Jorge E.; Ginocchio, Christine C.; Curtiss, Roy; Gyles, Carlton

doi:10.1016/0890-8508(92)90002-f

Cited by 861 publications

(678 citation statements)

References 36 publications

Supporting

Mentioning

618

Contrasting

Unclassified

Order By: Relevance

“…was extracted as per the protocol of Rawool et al, (2007). Primers for Salmonella organism was used according Rahn et al, (1992) for invA gene. Sequence of forward primer (invA) was GTGAAATTATCGCCACGTTCGGGCA A) and reverse primer was TCATCGCACCGTCAAAGGAACC).…”

Section: Molecular Characterization Of Isolated Strains Using Polymermentioning

confidence: 99%

Studies on Occurrence of Invasive Salmonella spp. from Unorganised Poultry Farm to Retail Chicken Meat Shops in Mumbai City, India

Waghamare¹,

Paturkar²,

Zende³

et al. 2017

Int.J.Curr.Microbiol.App.Sci

View full text Add to dashboard Cite

Section: Molecular Characterization Of Isolated Strains Using Polymermentioning

confidence: 99%

Studies on Occurrence of Invasive Salmonella spp. from Unorganised Poultry Farm to Retail Chicken Meat Shops in Mumbai City, India

Waghamare¹,

Paturkar²,

Zende³

et al. 2017

Int.J.Curr.Microbiol.App.Sci

View full text Add to dashboard Cite

“…Further characterization was done to determine pathogenicity genes in Salmonella enterica isolates. Specific molecular tests, confirmed the presence of genes: invA, fimbC, histidine transport and JEO-4 reported as evidence of plathogenicity in Salmonella species [16,17]. The genes invA and FimC are both essential in the eukaryotic cell invasion [18].…”

Section: Discussionmentioning

confidence: 83%

Isolation of Lytic Bacteriophages for Nanobiocontrol of Pathogenic and Antibiotic Resistant Salmonella Present in Poultry in Ecuador

Quiroz¹,

Recalde²,

Arias³

et al. 2016

Biol Med (Aligarh)

View full text Add to dashboard Cite

The genus Salmonella, as many others bacteria, has been frequently reported as resistant to commonly used antibiotics in poultry, therefore, the current spread of antibiotic resistance genes in bacteria, raises doubts on the effectiveness of antibiotics in the future. One possible alternative to antibiotics is the use of bacteriophages as antimicrobial agents to control antibiotic resistant pathogenic bacteria. The main goal of this project was to isolate and use bacteriophages as a new, safe, and effective biocontrol method for treating infectious diseases caused by Salmonella entero-pathogena. Four lytic bacteriophages cocktails (PSEA-2, SSEA, PSIA-2, SSIA) were isolated from wastewater of poultry processing industries, to control Salmonella enterica subsp entérica serovar Enteritidis (SE), and Salmonella entérica subsp enterica serovar Infantis (SI), under laboratory conditions. We found the cocktails PSEA-2 and PSIA-2 specific for SE and SI while cocktails SSEA and SSIA also caused lysis in Pseudomona. The observations in the Transmission Electron Microscope (TEM) revealed the presence of tailed phages of the Siphovididae and Myoviridae families; and a polyhedral phage. We have isolated specific phages and tested in vitro their effectiveness at controlling Salmonella. Further studies are needed in order to assess the phage effectiveness in vivo.

show abstract

“…The primers used were Salm3 (5′GCTGCGCGCGAACGGCGAAG-3′) and Salm4 (5′TCCCGGCAGAGTTCCCATT-3′), which amplify a 389-bp fragment within the conserved invA gene sequence of Salmonella spp. [11]. Data of culture and PCR results were tested for correlation (spearman, s rho) and analyzed by computer using Statistical Package for Science (SPSS) version 21 program.…”

Section: Methodsmentioning

confidence: 99%

Detection of Salmonella in Food Samples by Culture and Polymerase Chain Reaction Methods

AI¹

2014

J Bacteriol Parasitol

View full text Add to dashboard Cite

Conventional culture methods for the isolation and identification of food borne bacterial pathogens are rather sensitive and quite inexpensive, but at the same time they are labor-intensive and time-consuming. Molecular techniques are more rapid and highly sensitive for identification of food pathogens. This study was carried out to evaluate a 12 hour PCR method for detection of Salmonella in food samples. The results showed that out of 150 food samples, 32 (21.3%) were positive by culture, 35 (23.3%) were positive by PCR, the sensitivity of PCR was 100% while specificity was 97.5%. The study concluded that the 6-h enrichment followed by PCR was rapid, simpler method that allowed the detection of Salmonella spp. within a maximum of 12 h.

show abstract

Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella

Cited by 861 publications

References 36 publications

Studies on Occurrence of Invasive Salmonella spp. from Unorganised Poultry Farm to Retail Chicken Meat Shops in Mumbai City, India

Studies on Occurrence of Invasive Salmonella spp. from Unorganised Poultry Farm to Retail Chicken Meat Shops in Mumbai City, India

Isolation of Lytic Bacteriophages for Nanobiocontrol of Pathogenic and Antibiotic Resistant Salmonella Present in Poultry in Ecuador

Detection of Salmonella in Food Samples by Culture and Polymerase Chain Reaction Methods

Contact Info

Product

Resources

About