AMPK facilitates the hypoxic ventilatory response through non-adrenergic mechanisms at the brainstem

Abstract

We recently demonstrated that the hypoxic ventilatory response (HVR) is facilitated by the AMP-activated protein kinase (AMPK) in catecholaminergic neural networks that likely lie downstream of the carotid bodies within the caudal brainstem. Here, we further subcategorise the neurons involved, by cross-comparison of mice in which the genes encoding the AMPK-α1 (Prkaa1) and AMPK-α2 (Prkaa2) catalytic subunits were deleted in catecholaminergic (TH-Cre) or adrenergic (PNMT-Cre) neurons. As expected, the HVR was markedly attenuated in mice with AMPK-α1/α2 deletion in catecholaminergic neurons, but surprisingly was modestly augmented in mice with AMPK-α1/α2 deletion in adrenergic neurons when compared against a variety of controls (TH-Cre, PNMT-Cre, AMPK-α1/α2 floxed). Moreover, AMPK-α1/α2 deletion in catecholaminergic neurons precipitated marked hypoventilation and apnoea during poikilocapnic hypoxia, relative to controls, while mice with AMPK-α1/α2 deletion in adrenergic neurons entered relative hyperventilation with reduced apnoea frequency and duration. We conclude, therefore, that AMPK-dependent modulation of non-adrenergic networks may facilitate increases in ventilatory drive that shape the classical HVR, whereas AMPK-dependent modulation of adrenergic networks may provide some form of negative feedback or inhibitory input to moderate HVR, which could, for example, protect against hyperventilation-induced hypocapnia and respiratory alkalosis.

SubSol-HIe is an AMPK-dependent hypoxia-responsive subnucleus of the nucleus tractus solitarius that coordinates the hypoxic ventilatory response and protects against apnoea in mice

“…Previously, targeted deletion of AMPK-α1 and AMPK-α2 in brainstem catecholaminergic cells through Cre expression via the tyrosine hydroxylase promoter (TH-AMPK-α1/α2 knockout) was confirmed by single-cell end-point PCR, by viral injection of a Cre-inducible vector carrying a reporter gene [ 59 ] and by crossing TH-AMPK-α1/α2 knockout mice with mice engineered for Cre-dependent expression of Rosa (tdTomato) and subsequent analysis by confocal imaging of caudal brainstem areas [ 57 ].…”

“…The overall shape of the DAR indicated that several anatomical subnuclei of the NTS were likely affected by AMPK deficiency. Surprisingly, AMPK deletion and subsequent reductions in neuronal activity within the DAR were associated with attenuation of the hypoxic ventilatory response (HVR) at the peak of the augmenting phase (~ 30 s), roll-off (~ 100 s) and the sustained phase (~ 100 s) [ 56 , 57 , 59 ] , but not cardiovascular responses to hypoxia [ 56 ]. This is despite the fact that both cardiovascular and respiratory compartments of the ventrolateral medulla (VLM) are in receipt of NTS afferent inputs.…”

“…The presence of wild-type or floxed AMPK-α1 and AMPK-α2 alleles and Cre recombinase [ 56 , 57 , 59 ] was detected by PCR of digested ear clip tissue. Three primers were used to detect TH Cre (forward 5′ CACCCTGACCCAAGCACT 3′; reverse 5′ CTTTCCTTCCTTTATTGAGAT 3′; internal positive control 5′ GATACCTGGCCTGGTCTCG 3′; expected size WT = 290 bp, Cre = 390 bp), and two primers were used for each AMPK catalytic subunit: α1-forward 5′ TATTGCTGCCATTAGGCTAC 3′, α1-reverse: 5′ GACCTGACAGAATAGGATATGCCCAACCTC 3′ (WT = 588 bp, floxed = 682 bp); α2-forward 5′ GCTTAGCACGTTACCCTGGATGG 3′, α2-reverse: 5′ GTTATCAGCCCAACTAATTACAC 3′ (WT = 204 bp, floxed = 250 bp).…”

“…As described previously [ 56 , 57 , 59 ], we used a whole-body unrestrained plethysmograph, incorporating a Halcyon™ low noise pneumatochograph (Buxco Research Systems, UK) coupled to FinePointe acquisition and analysis software (Data Science International, USA). Following acclimation and baseline measurements (awake but quiet, undisturbed periods of breathing) under normoxia (room air), mice were exposed to hypoxia (8% O 2 , with 0.05% CO 2 , balanced with N 2 ) for 10 min or 60 min.…”

Body and mind: how somatic feedback signals shape brain activity and cognition

“…The Special Issue unites four comprehensive reviews on somatic feedback signals and brain function, covering its potential cognitive-behavioral significance [12,17], the role of slow (respiratory) nasal feedback signals for brain dynamics [19] and the role of rhythmic oxygen pressure oscillations for potential neuronal effects of respiration [39]. Five original articles address specific effects of respiration on gamma oscillations [14], the state-dependence of respiration-cortical activity coupling [18], entrainment of brainstem neurons of the reticular formation by cardiac activity Kocsis and Topchyi [23], the molecular mechanisms linking hypoxia-mediated activation of carotid bodies to increased ventilation [25] and a new neuromodulatory effect on respiratory rhythm generation in brainstem networks by the peptide bombesin [27]. Finally, a systematic literature review summarizes the evidence for, or against, consistent changes of pupil diameter with respiration.…”