Ammonium Concentrations in Produced Waters from a Mesothermic Oil Field Subjected to Nitrate Injection Decrease through Formation of Denitrifying Biomass and Anammox Activity

Abstract

Community analysis of a mesothermic oil field, subjected to continuous field-wide injection of nitrate to remove sulfide, with denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rRNA genes indicated the presence of heterotrophic and sulfide-oxidizing, nitrate-reducing bacteria (hNRB and soNRB). These reduce nitrate by dissimilatory nitrate reduction to ammonium (e.g., Sulfurospirillum and Denitrovibrio) or by denitrification (e.g., Sulfurimonas, Arcobacter, and Thauera). Monitoring of ammonium concentrations in producing wells (PWs) indicated that denitrification was the main pathway for nitrate reduction in the field: breakthrough of nitrate and nitrite in two PWs was not associated with an increase in the ammonium concentration, and no increase in the ammonium concentration was seen in any of 11 producing wells during periods of increased nitrate injection. Instead, ammonium concentrations in produced waters decreased on average from 0.3 to 0.2 mM during 2 years of nitrate injection. Physiological studies with produced waterderived hNRB microcosms indicated increased biomass formation associated with denitrification as a possible cause for decreasing ammonium concentrations. Use of anammox-specific primers and cloning of the resulting PCR product gave clones affiliated with the known anammox genera "Candidatus Brocadia" and "Candidatus Kuenenia," indicating that the anammox reaction may also contribute to declining ammonium concentrations. Overall, the results indicate the following: (i) that nitrate injected into an oil field to oxidize sulfide is primarily reduced by denitrifying bacteria, of which many genera have been identified by DGGE, and (ii) that perhaps counterintuitively, nitrate injection leads to decreasing ammonium concentrations in produced waters.

Implications of Limited Thermophilicity of Nitrite Reduction for Control of Sulfide Production in Oil Reservoirs

“…The tNRB in 18PW may be derived from deeper, hotter subsurface layers connected to the low-temperature MHGC reservoir, which is at 780 m below the surface. The presence of high fractions and activity of denitrifying mNRB in MHGC produced waters has been shown before (33,47). Toluene and ethylbenzene were also used as electron donors to reduce nitrate (see Fig.…”

Compositions of microbial communities associated with oil and water in a mesothermic oil field

“…Although ammonium was found in the Enermark field in submillimolar concentrations, preferential denitrification of the injected nitrate combined with anammox (Cornish-Shartau et al 2010) can lead to a lack of NH 3 and abundance of N 2 in some zones of the oil reservoir. Therefore, Rhizobiales, together with some other bacteria (e.g.…”

Microbial community shifts on an anammox reactor after a temperature shock using 454-pyrosequencing analysis

“…Samples were amplified for pyrosequencing using a forward and reverse fusion primer. The forward primer was constructed with (5 0 -3 0 ) the Roche A linker (CCATCTCATCCCTGCG TGTCTCCGACTCAG), an 8 bp barcode and the appropriated forward primer selected for bacteria diversity assay (530F: GTGCCAGC MGCNGCGG) or for anammox specific diversity assay (Amx368F: TTCGCAATGCCCGAAAGG; (Cornish Shartau et al, 2010). The reverse fusion primer was constructed with (5 0 -3 0 ) a biotin molecule, the Roche B linker (CCTATCCCCTGTGTGCCTTGGCAGTCTCAG), and the proper reverse primer for bacteria diversity assay (1100R: GGGTTNCGNTCGTTR) or for anammox specific diversity assay (Amx820R: AAAACCCCTCTACTTAGTGCCC; Cornish Shartau et al…”