Aminoglycoside antibiotics perturb physiologically important microRNA contributing to drug toxicity

Jayaraj, Gopal Gunanathan; Ramasamy, Soundhar; Bose, Debojit; Suryawanshi, Hemant; Lalwani, Mukesh Kumar; Sivasubbu, Sridhar; Maiti, Souvik

doi:10.1101/137935

Cited by 3 publications

(3 citation statements)

References 50 publications

(51 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Nonspecific binding, which is closely related to electrostatic 76,77 and stacking interactions 78,79 , cause many side effects when tested clinically [80][81][82] . Despite recent efforts on designing drug-like small molecules while overcoming non-specific binding to RNAs 21,83,84 , selectivity is still a challenge.…”

Section: Discussionmentioning

confidence: 99%

Conformational Dynamics of RNA G4C2 and C2G4 Repeat Expansions causing ALS/FTD using NMR and Molecular Dynamics Studies

Disney

Taghavi

Baisden

et al. 2023

Preprint

View full text Add to dashboard Cite

RNA G4C2 and C4G2 repeat expansions in the chromosome 9 open reading frame 72 gene (C9orf72) are the most common cause of genetically defined amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), referred to as c9ALS/FTD. The gene is bidirectionally transcribed, producing G4C2 repeats, r(G4C2)exp, in the sense and C4G2 repeats, r(C4G2)exp, in the antisense strands. Akin to other repeat expansions, those operating in c9ALS/FTD are highly structured, which contributes to their gain-of-function mechanism. Structural studies have revealed that r(G4C2)exp predominantly folds into a hairpin, which has periodic arrays of 1×1 G/G internal loops and a G-quadruplex. Recent studies on small molecule probes revealed that r(G4C2)exp adopts a new hairpin structure in which the 1×1 G/G internal loops transform into 2×2 GG/GG internal loops. We first evaluated the performance of four different RNA force fields with conventional MD simulations and showed that only the one having revised χ and α/γ torsional parameters maintained the helicity of a model r(G4C2)2. We then used this force field to study the conformational dynamics adopted by 2×2 GG/GG loops in a model system of r(UCUGGGGCCAGA)2 using temperature replica exchange molecular dynamics (T-REMD) simulations covering over 1.7 ms cumulative simulation time. We further characterized the structure and underlying dynamics of these internal loops using traditional 2D NMR techniques, illustrating the possibility of adopting different configurations around the glycosidic bond, i.e., anti vs. syn, using a hairpin model, r(CCAGGGCAAGGAAACUUGGGCUGG). Results display that closing base pairs play an important role in the structure and dynamics of these systems with the most preferred configuration being in syn-anti/anti-syn and anti-syn/anti-syn. Analogous studies on r(C4G2) repeats, which fold into an array of 2×2 CC/CC internal loops, revealed that this structure is not as dynamic as 2×2 GG/GG internal loops, where the residues adopt all anti configurations, although the dynamics of the loop residues is affected by the closing base pairs. Collectively, these studies emphasize the unique sensitivity of r(G4C2)exp to small changes in stacking interactions, which is not observed in r(C4G2)exp, providing important considerations for further principles in structure-based drug design.

show abstract

Section: Discussionmentioning

confidence: 99%

Conformational Dynamics of RNA G4C2 and C2G4 Repeat Expansions causing ALS/FTD using NMR and Molecular Dynamics Studies

Disney

Taghavi

Baisden

et al. 2023

Preprint

View full text Add to dashboard Cite

show abstract

“…Indeed, aminoglycosides promiscuously bind RNA through electrostatic interactions (Wong et al 1998;Walter et al 1999;Verhelst et al 2004) while intercalators bind to RNAs nonspecifically through hydrophobic and π-stacking interactions (Tanner and Cech 1985;White and Draper 1987;Tanious et al 1992). Both are known to have many side effects when used clinically due to this nonspecific RNA binding (Xie et al 2011;Callejo et al 2015;Hong et al 2015;Gunanathan Jayaraj et al 2017). Additionally, many RNA drug targets lack tertiary structure and form highly flexible structures that can adaptively bind to a variety of small molecules (Hermann and Patel 2000;Bardaro et al 2009;Stelzer et al 2011).…”

Section: Introductionmentioning

confidence: 99%

Understanding the characteristics of nonspecific binding of drug-like compounds to canonical stem–loop RNAs and their implications for functional cellular assays

Kelly

Chu

Shi

et al. 2020

RNA

View full text Add to dashboard Cite

Identifying small molecules that selectively bind an RNA target while discriminating against all other cellular RNAs is an important challenge in RNA-targeted drug discovery. Much effort has been directed toward identifying drug-like small molecules that minimize electrostatic and stacking interactions that lead to nonspecific binding of aminoglycosides and intercalators to many stem–loop RNAs. Many such compounds have been reported to bind RNAs and inhibit their cellular activities. However, target engagement and cellular selectivity assays are not routinely performed, and it is often unclear whether functional activity directly results from specific binding to the target RNA. Here, we examined the propensities of three drug-like compounds, previously shown to bind and inhibit the cellular activities of distinct stem–loop RNAs, to bind and inhibit the cellular activities of two unrelated HIV-1 stem–loop RNAs: the transactivation response element (TAR) and the rev response element stem IIB (RREIIB). All compounds bound TAR and RREIIB in vitro, and two inhibited TAR-dependent transactivation and RRE-dependent viral export in cell-based assays while also exhibiting off-target interactions consistent with nonspecific activity. A survey of X-ray and NMR structures of RNA-small molecule complexes revealed that aminoglycosides and drug-like molecules form hydrogen bonds with functional groups commonly accessible in canonical stem–loop RNA motifs, in contrast to ligands that specifically bind riboswitches. Our results demonstrate that drug-like molecules can nonspecifically bind stem–loop RNAs most likely through hydrogen bonding and electrostatic interactions and reinforce the importance of assaying for off-target interactions and RNA selectivity in vitro and in cells when assessing novel RNA-binders.

show abstract

“…Indeed, aminoglycosides promiscuously bind RNA through electrostatic interactions (Wong et al 1998;Walter et al 1999;Verhelst et al 2004) while intercalators bind to RNAs nonspecifically through hydrophobic and p-stacking interactions (Tanner and Cech 1985;Tanious et al 1992;White and Draper 1987). Both are known to have many side effects when used clinically due to non-specific RNA binding (Gunanathan Jayaraj et al 2017;Hong et al 2015;Xie et al 2011;Callejo et al 2015;Sharifi and Aragon-Ching 2012). Additionally, many RNA drug targets lack tertiary structure, and form highly flexible structures that can adaptively bind to a variety of small molecules (Bardaro et al 2009;Hermann and Patel 2000;Stelzer et al 2011).…”

Section: Introductionmentioning

confidence: 99%

Revealing the high propensity of RNAs to non-specifically bind drug-like small molecules

Kelly

Chu²,

Shi

et al. 2020

Preprint

View full text Add to dashboard Cite

Identifying small molecules that selectively bind a single RNA target while discriminating against all other cellular RNAs is an important challenge in RNA-targeted drug discovery. Much effort has been directed toward identifying drug-like small molecules that minimize electrostatic and stacking interactions that lead to non-specific binding of aminoglycosides and intercalators to a variety of RNAs. Many such compounds have been reported to bind RNAs and inhibit their cellular activities, however the ability of such compounds to discriminate against RNA stem-loops commonly found in the transcriptome has not been thoroughly assessed in all cases. Here, we examined the propensities of three drug-like compounds, previously shown to bind and inhibit the cellular activity of three distinct RNAs, to non-specifically bind two HIV-1 stem-loop RNAs: the transactivation response element (TAR) and stem IIB in the rev response element (RREIIB). All three compounds bound to TAR and RREIIB in vitro, and two inhibited TAR-dependent transactivation and RRE-dependent viral export in cell-based assays while also exhibiting substantial off-target interactions consistent with non-specific cellular activity. A survey of X-ray and NMR structures of RNA-small molecule complexes revealed that drug-like molecules form hydrogen bonds with functional groups commonly accessible in canonical stem-loop RNA motifs, much like aminoglycosides, and in contrast to ligands that specifically bind riboswitches. Our results support extending the group of non-selective RNA-binders beyond aminoglycosides and intercalators to encompass drug-like compounds with capacity for non-specific hydrogen-bonding and reinforce the importance of assaying for off-target interactions and RNA selectivity in vitro and in cells when assessing novel RNA-binders.

show abstract

Aminoglycoside antibiotics perturb physiologically important microRNA contributing to drug toxicity

Cited by 3 publications

References 50 publications

Conformational Dynamics of RNA G4C2 and C2G4 Repeat Expansions causing ALS/FTD using NMR and Molecular Dynamics Studies

Conformational Dynamics of RNA G4C2 and C2G4 Repeat Expansions causing ALS/FTD using NMR and Molecular Dynamics Studies

Understanding the characteristics of nonspecific binding of drug-like compounds to canonical stem–loop RNAs and their implications for functional cellular assays

Revealing the high propensity of RNAs to non-specifically bind drug-like small molecules

Contact Info

Product

Resources

About