AM-Induced Alteration in the Expression of Genes, Encoding Phosphorus Transporters and Enzymes of Carbohydrate Metabolism in Medicago lupulina

Abstract

Plant–microbe interactions, including those of arbuscular mycorrhiza (AM), have been investigated for a wide spectrum of model plants. The present study focuses on an analysis of gene expression that encodes phosphate and sugar transporters and carbohydrate metabolic enzymes in a new model plant, the highly mycotrophic Medicago lupulina MLS-1 line under conditions of phosphorus deficiency and inoculation with Rhizophagus irregularis. Expression profiles were detected by RT-PCR at six plant stages of development (second leaf, third leaf, shooting, axillary shoot branching initiation, axillary shoot branching, flowering initiation). In comparison to control (without AM), the variant with AM inoculation exhibited a significant elevation of transcription levels of carbohydrate metabolic enzymes (MlSUS, MlHXK1) and sucrose transporters (MlSUC4) in M. lupulina leaves at the shooting stage. We suggest that this leads to a significant increase in the frequency of AM infection, an abundance of mycelium in roots and an increase in AM efficiency (which is calculated by the fresh weight of aerial parts and roots at the axillary shoot branching initiation stage). In roots, the specificity of MlPT4 and MlATP1 gene expressions were revealed for effective AM symbiosis. The level of MlPT4 transcripts in AM roots increased more than tenfold in comparison to that of non-specific MlPT1 and MlPT2. For the first time, MlPT1 expression was shown to increase sharply against MlPT2 in M. lupulina roots without AM at the shooting initiation stage. A significant increase in MlRUB expression was revealed at late stages in the host plant’s development, during axillary shoot branching and flowering initiation. The opposite changes characterized MlHXK1 expression. Alteration in MlHXK1 gene transcription was the same, but was more pronounced in roots. The obtained results indicate the importance of genes that encode phosphate transporters and the enzymes of carbohydrate metabolism for effective AM development at the shooting stage in the host plant.

The effect of inoculation with Rhizophagus irregularis on the expression level of phosphate transporter genes in the roots of Medicago lupulina under conditions of low phosphorus level in the substrate

“…This was preceded by the stage with high expression of the MtPT2 gene (above the expression level of the reference gene, actin). It should be assumed, at the beginning of stemming, plants without AM begin to experience significant phosphate starvation, which can be judged by the delay at the development stage and the lag in the dynamics of physiological parameters relative to the variant with AM [20]. Based on the fact that plants without AM are able to flower and bear fruit under such stressful conditions of low Pi, it can be supposed it is MtPT1 that plays an important role in the adaptation of plants without AM to conditions of low Pi levels in the soil.…”

“…cDNA synthesis was performed using the Maxima First Strand cDNA synthesis kit with dsDNase according to Thermo Scientific protocol from 1 μg total RNA for each sample. Real-time PCR for the following genes was performed using the presented primer sets: MlPT1 (PT1-2F "TACTCACTCACATTCTTCTTTGC" and PT1-2R "CCAAGCATGATAAGAGAGTTCTTA"; MN737457), MlPT2 (PT2-2F "CAGAACAAGGACAAGAGTAAAGC" and PT2-2R "CCGTTTTGTTATGAGAATGAGATTG"; MN737458), MlPTGC4 (PT4-1F "RGGGATTGA" "GGCCACACCGGTGACTAAG"; MN737459) and MlATP1 (ATP1-2F "CCTTTGTCATGGGTTATGGAAG" and ATP1-2R "CATTTTCCGTCGCGAAGTACC"; MN737456), MlActin (beta actin as a reference gene; actin7-f2 "GGCAGATGCTGAGGATATTCAA" and actin7-r2 "GTATGACGAGGTCGGCCAA"; MN756679) according to [20]. The level of gene expression was assessed using the BioRad CFX-96 thermocycler (BioRad, USA) and using the qPCR-RT reagent kit in the presence of SYBR Green I: +95°C, 10 min, 1 cycle; +95 °C, 15 sec, +60 °C, 30 sec, +72 °C, 30 sec, 40 cycles.…”

“…It was found that ATPase creates a proton gradient necessary for the transfer of phosphates through the periarbuscular membrane [19]. Since the H+-dependent ATPase gene is expressed only in the presence of AM fungi, it can be argued that this gene is specific for AM symbiosis [19,20].…”

The Effects of Rhizophagus irregularis Inoculation on Transcriptome of Medicago lupulina Leaves at Early Vegetative and Flowering Stages of Plant Development

“…The transcriptomic analysis of the model PMS "Medicago lupulina + Rhizophagus irregularis", with MGR > 350% under conditions of phosphorus (P) deficiency for plant nutrition is promising [46]. The micro-vegetative experiments in M. lupulina provided in our earlier experiments during the development of AM symbiosis showed significant changes in the course of development and hormonal rearrangements in the host plant [47,48]; metabolic rearrangements [30,49]; and changes in the expression of a number of genes for carbohydrate metabolism and P transport [50].…”

Use of a RT-qPCR Method to Estimate Mycorrhization Intensity and Symbiosis Vitality in Grapevine Plants Inoculated with Rhizophagus irregularis

“…On the plant side, the most common genes used are the AMF-induced phosphate transporter genes, e.g., PT4 in Medicago truncatula , Lycopersicon esculentum and Solanum tuberosum [ 11 , 21 , 22 ], and PT11 in Oryza sativa [ 23 ]. They are reliable plant molecular markers of a functional AMF symbiosis [ 24 ]. In a previous work on grapevine, we also demonstrated that the presence of many arbuscules in the cortex was associated with a high-level expression of two phosphate transporter genes (PHT1) in roots [ 4 ].…”