Altered transcriptional regulation of phosphoenolpyruvate carboxykinase in rats following endotoxin treatment.

Hill, Molly R.; McCallum, R E

doi:10.1172/jci115381

Cited by 84 publications

(47 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Although IL-6 administration affects neither the regulation of gluconeogenesis nor the expression of hepatic PEPCK, it is capable of inhibiting glucagoninduced expression and activation of PEPCK [84]. This may suggest that IL-6 can actually improve hepatic insulin resistance in patients with Type 2 diabetes.…”

Section: Interaction Between Il-6 and Glucose Transport In Vivomentioning

confidence: 99%

Interleukin-6 and insulin sensitivity: friend or foe?

2004

View full text Add to dashboard Cite

Section: Interaction Between Il-6 and Glucose Transport In Vivomentioning

confidence: 99%

Interleukin-6 and insulin sensitivity: friend or foe?

2004

View full text Add to dashboard Cite

“…The DNA fragment was generated by polymerase sion. 23,24 chain reaction with primers 5 CAAGTGTAGCCCAGTAGAAC3…”

mentioning

confidence: 99%

Mechanism of the impairment of the glucagon-stimulated phosphoenolpyruvate carboxykinase gene expression by interleukin-6 in rat hepatocytes: Inhibition of the increase in cyclic 3?,5? adenosine monophosphate and the downstream cyclic 3?,5? adenosine monophosphate action

Christ¹,

Nath²,

Jungermann³

1997

Hepatology

View full text Add to dashboard Cite

ferase reporter gene construct under the control of a PCK In cultured rat hepatocytes, the gluconeogenic key enzyme, phosphoenolpyruvate carboxykinase (PCK), is induced by gene promoter fragment (base 0979 to base /32). Luciferase activity was determined after stimulation of the cells with glucagon via elevation of cyclic 3 ,5 adenosine monophosphate (cAMP). The proinflammatory cytokine, interleukin-6 CPT-cAMP in the absence or presence of IL-6. CPT-cAMP increased luciferase activity by 1.7-fold, which was inhibited (IL-6), which in the liver together with IL-1b and tumor necrosis factor a triggers the acute-phase response, had been shown in the presence of IL-6. It is concluded that IL-6 had a dual inhibitory effect on the stimulation of PCK gene expression to attenuate the glucagon-induced increase in PCK gene transcription, messenger (mRNA) levels, and enzyme activity. The by glucagon. It inhibited the increase in cAMP at a site before cAMP formation by adenylate cyclase and at a site after cAMP molecular mechanism of this inhibition was investigated in the present study. Glucagon increased cyclic cAMP and PCK formation, the activation of the PCK gene promoter by cAMP.(HEPATOLOGY 1997;26:73-80.) mRNA levels to a transient maximum twofold and fivefold, respectively. The increases were attenuated by IL-6. Forskolin, which stimulates adenylate cyclase activity, increasedIn the liver, the proinflammatory cytokine, interleukin-6 cAMP and PCK mRNA levels 1.6-fold and fivefold, respec-(IL-6), triggers the acute-phase response, which is mainly tively. However, IL-6 attenuated the forskolin-stimulated in-characterized by the increased synthesis and secretion of poscrease in PCK mRNA but not the increase in cAMP. This itive acute-phase plasma proteins and the decreased synthesis showed that IL-6 inhibited PCK mRNA increase in part by and secretion of negative acute-phase plasma proteins (for the attenuation of cAMP increase, but also beyond cAMP review, see Heinrich et al. 1 and Akira et al. 2 ). IL-6 binds to formation. This was confirmed in experiments in which PCK its 80-kd receptor at the cell surface, which associates with mRNA levels were increased by the nonhydrolyzable cAMP-a dimer of the signal-transducing 130-kd glycoprotein, analogue, chlorophenylthio (CPT)-cAMP. The increase in PCK gp130. 3,4 After the binding of IL-6 to its receptor, signal mRNA was again attenuated by IL-6. In pertussis toxin-and transduction is accomplished by two different routes in the in isobutylmethylxanthine-treated hepatocytes, IL-6 still in-cell. Phosphorylation on threonine of the basic leucine zipper hibited the glucagon-stimulated increase in cAMP, indicating transcription factor, C/EBPb (CAAT-box enhancer binding that IL-6 did not activate an inhibitory G-protein or phospho-protein b) (also termed NF-IL-6, IL-6-DBP, or LAP), leads diesterase, which could cause the impairment of cAMP in-to transcriptional activation of C/EBPb, which binds to C/ crease. To demonstrate whether the inhibition of PCK gene EBPb-binding sites in the ...

show abstract

“…The encoded protein may serve a similar function, although it is constitutively expressed and not modulated by the hormones, including glucagon and insulin, that regulate the cytosolic form. Hill et al reported that the direct action of TNF to decrease the PEPCK transcription rate was confirmed in vitro with H-4-II-E Reuber hepatoma cells (24). The authors suggested that PCK2 may be associated with hepatocarcinogenesis.…”

Section: Discussionmentioning

confidence: 98%