Altered gene expression in Schwann cells of connexin32 knockout animals

Abstract

The discovery that the dominant X-linked form of Charcot-Marie-Tooth disease (CMTX), a genetic disease of the peripheral nervous system (PNS), is associated with mutations in connexin32 (Cx32) has brought attention to the importance of connexins in glial cell biology. To gain further insight into the consequences of Cx32 deficiency, we have undertaken a detailed characterization of the gene expression profile of Schwann cells isolated from the sciatic nerve of wild-type and Cx32-null mice. Schwann cells exhibit two distinct phenotypes, myelinating and nonmyelinating, which are defined by their different morphology with respect to axons and by their unique profile of gene expression. Our findings show that, regardless of the mouse genotype, cultured Schwann cells express similar levels of messages for a number of connexins and for genes characteristic of both the myelinating and the nonmyelinating phenotypes. Furthermore, we have identified Cx36, a member of the gamma subclass of connexins, which are preferentially expressed in neuronal cells of mouse brain and retina, as an additional connexin present in Schwann cells. Mice lacking Cx32, however, exhibited a marked up-regulation of glial fibrillary acidic protein (GFAP), a cytoskeletal protein usually synthesized only by nonmyelinating Schwann cells. This observation was extended to the PNS in vivo and did not reflect a general perturbation of the expression of other nonmyelinating Schwann cell genes. These findings demonstrate that the absence of Cx32 results in a distinct pattern of gene dysregulation in Schwann cells and that Schwann cell homeostasis is critically dependent on the correct expression of Cx32 and not just any connexin. Identifying the relationship between increased GFAP expression and the absence of Cx32 could lead to the definition of specific roles for Cx32 in the control of myelin homeostasis and in the development of CMTX.

Exocrine specific expression of Connexin32 is dependent on the basic helix-loop-helix transcription factor Mist1

“…5A) and neuronal supporting cells (data not shown), both of which do not undergo regulated exocytosis and only express Cx32 but not Mist1 (Fig. 5A) (Evert et al, 2002;Meda et al, 1993;Nicholson et al, 2001;Pin et al, 2000). Analysis of various tissues in Mist1 KO animals also revealed a striking correlation between Mist1 and Cx32 gene expression.…”

Plasma Membrane Channels Formed by Connexins: Their Regulation and Functions

“…to neuropathy but also to reduced nerve stimulation-and hormone-induced hepatic glucose release (409,563) and reduced bile flow (574) following sympathetic stimulation, reduced fluid secretion by lacrimal glands (628), and an increased amylase secretion from the exocrine pancreas (81). The absence of Cx32 results in a distinct pattern of gene dysregulation in Schwann cells (415). However, Cx32-null mice show a normal organization of central nervous system myelin (517).…”

The Structural and Functional Integrity of Peripheral Nerves Depends on the Glial-Derived Signal Desert Hedgehog

“…For the sciatic nerve extracts, reactions were cycled through one cycle at 94°C for 3 min, followed by 30 rounds (27 for GAPDH) at 94°C for 30 s, 62°C (MBP, MAG, cx32, S100) for 30 s, 55°C (cx29 and JAM) for 45 s, 63°C (GAPDH) for 30 s, 72°C for 30 s, and one final extension at 72°C for 5 min. The primer pairs were as follows: MBP: forward primer 5ЈACTCA-CACACGAGAACTACCCA3Ј, reverse primer 5ЈCCAGCTAAATCT-GCTGAGGG 3Ј (169 bp) (Nicholson et al, 2001); MAG: forward primer 5ЈGGAGACCTGGGCCTACGAAA3Ј, reverse primer 5ЈGACGTCCA-AACTGGCGTAAC3Ј (442 bp) (Nicholson et al, 2001); cx32: forward primer 5ЈTACGTGGCGTGAATCGGCAC3Ј, reverse primer 5ЈGTTG-GTGAGCTACGTGCATT3Ј (266 bp) (Nicholson et al, 2001); cx29: forward primer 5ЈATGTGCGGCAGGTTCCTGAGACA3Ј, reverse primer 5ЈTCAAAATGGCTCTTTTGCCTCCA3Ј (777 bp) (Sohl et al, 2001); S100: forward primer 5ЈGGTGACAAGCACAAGCTGAA3Ј, reverse primer 5ЈCTGGAAGTCACACTCCCCA3Ј (150 bp) (Nicholson et al, 2001); JAM2: forward primer 5ЈGTCGCACAGATGTGTTTGG3Ј, reverse primer 5ЈGAGTTCACATGGAAAGAGG3Ј (327 bp); JAM3: forward primer 5ЈTTGGTCTACTACCAACAGG3Ј, reverse primer 5ЈTT-TCGTGTTCATTGTGTACG3Ј (369 bp). For Ptc1 reverse transcription (RT)-PCR of Schwann cells, 1 l of cDNA was used in a 50 l PCR mixture that was subjected to one cycle at 94°C for 3 min, followed by 35 cycles at 94°C for 30 s, 55°C for 1 min, 72°C for 30 s, and one final extension at 72°C for 5 min [Ptc1: forward primer 5ЈAACAAAAAT-TCAACCAAACCTC3Ј, reverse primer 5ЈTGTCTTCATTCCAGTT-GATGTG3Ј (244 bp) (Takabatake et al, 1997); Cld5: forward primer 5ЈGAAGGGGCTGTGGATGTC3Ј, reverse primer 5ЈACCGTCGGAT-CATAGAAC3Ј (314 bp) (Poliak et al, 2002)].…”