Alterations in carbohydrate metabolism and its regulation in PPARα null mouse hearts

Abstract

Although a shift from fatty acids (FAs) to carbohydrates (CHOs) is considered beneficial for the diseased heart, it is unclear why subjects with FA ␤-oxidation defects are prone to cardiac decompensation under stress conditions. The present study investigated potential alterations in the myocardial utilization of CHOs for energy production and anaplerosis in 12-wkold peroxisome proliferator-activating receptor-␣ (PPAR␣) null mice (a model of FA ␤-oxidation defects). Carbon-13 methodology was used to assess substrate flux through energy-yielding pathways in hearts perfused ex vivo at two workloads with a physiological substrate mixture mimicking the fed state, and real-time RT-quantitative polymerase chain reaction was used to document the expression of selected metabolic genes. When compared with that from control C57BL/6 mice, isolated working hearts from PPAR␣ null mice displayed an impaired capacity to withstand a rise in preload (mimicking an increased venous return as it occurs during exercise) as reflected by a 20% decline in the aortic flow rate. At the metabolic level, beyond the expected shift from FA (5-fold down) to CHO (1.5-fold up; P Ͻ 0.001) at both preloads, PPAR␣ null hearts also displayed 1) a significantly greater contribution of exogenous lactate and glucose and/or glycogen (2-fold up) to endogenous pyruvate formation, whereas that of exogenous pyruvate remained unchanged and 2) marginal alterations in citric acid cycle-related parameters. The lactate production rate was the only measured parameter that was affected differently by preloads in control and PPAR␣ null mouse hearts, suggesting a restricted reserve for the latter hearts to enhance glycolysis when the energy demand is increased. Alterations in the expression of some glycolysis-related genes suggest potential mechanisms involved in this defective CHO metabolism. Collectively, our data highlight the importance of metabolic alterations in CHO metabolism associated with FA oxidation defects as a factor that may predispose the heart to decompensation under stress conditions even in the fed state. isolated working mouse heart perfusion; citric acid cycle; 13 C isotopomer analysis; glycolysis; ATP-citrate lyase; peroxisome proliferator-activated receptor-␣ IN THE HEALTHY adult heart, the concerted regulation of longchain fatty acid (LCFA) and carbohydrate (CHO) metabolism ensures optimal energy production, in which LCFAs are often considered to be the predominant energy substrate under most conditions. This contrasts with the hypertrophied and/or failing heart, which displays a shift from LCFAs toward CHOs utilization that has been attributed, at least in part, to the deactivation of peroxisome proliferator-activated receptor-␣ (PPAR␣) (5,12,28,36,41). This nuclear transcription factor, which is highly expressed in the heart, is known to be activated by fatty acids (FAs) and to regulate the expression of genes encoding for LCFA uptake and oxidation (7). Although this shift from LCFAs to CHOs for energy production has been shown to be benef...

Mouse strain differences in metabolic fluxes and function of ex vivo working hearts

“…Our previously published studies (17,26,41) have defined 13 C-terminology and described measurement by gas chromatography-mass spectrometry (Agilent 6890N GC coupled with a 5973N mass spectrometer) as well as equations for the calculation of 1) flux ratios relative to substrate selection for mitochondrial citrate synthesis (CS) from the 13 C-enrichment of acetyl (carbons 4 and 5) and oxaloacetate (carbons 1, 2, 3, and 6) moieties of citrate, 2) absolute flux rates for the citric acid cycle (CAC) from the stoichiometric relationship between oxygen consumption and citrate formation from various substrates assessed from determined flux ratios, and 3) efflux rates of unlabeled lactate and pyruvate reflecting cytosolic glycolysis from exogenous glucose (by [U-13 C6]glucose perfusion).…”

“…We selected 1) genes involved in FA oxidation, namely, acyl-CoA oxidase 1 (Acox1), medium-chain acyl-CoA dehydrogenase (Acadm), carnitine palmitoyltransferase 1b (Cpt1b); 2) genes related to CHO metabolism or its regulation, such as glucose transporter-4 (Slc2a4), phosphofructokinase-1 (Pfkm), phosphofructokinase-2 (Pfk2), pyruvate dehydrogenase kinase 4 (Pdk4); and 3) genes related to mitochondrial biogenesis peroxisome proliferative activated receptor ␥ coactivator 1 ␣ (Ppargc1a). RTquantitative PCR was performed as described previously (17).…”

“…Gene primer pairs not reported previously (17,18) are Acox1 (forward: CTTCCAATCATGCGATAGTCC; reverse: TTGTCCATCTTCAGG-TAGCC), Cpt1b (forward: ACCAGTCTTAGCCTCTACG; reverse: TG-TAGCCCAGGTGAAAGG), Pfk2 (forward: ACCAGTCTTAGCCTC-TACG; reverse: GTCTACAGCATCCACATTCAG), and Ppargc1a (forward: TGGATGAAGACGGATTGC; reverse: TGGTTCTGAGTG-CTAAGAC). Gene primers were generated with the Beacon Designer version 5.0 program using mouse sequences available in GenBank.…”

“…Our previous work with various transgenic mouse models does, however, provide some evidence of differences among commonly used control mouse strains, particularly in the partitioning of exogenous long-chain fatty acids (LCFA) for oxidation and storage between hearts from 129S6/SvEvTac versus various C57Bl/6 or C57Bl/10 substrains (17,18,26,27,30). These results were all obtained in our validated experimental paradigm, namely, ex vivo perfusion in working mode, with concomitant evaluation of myocardial contractility and metabolic fluxes with 13 C-labeled substrates.…”

Differential effects of high-fat diet on myocardial lipid metabolism in failing and nonfailing hearts with angiotensin II-mediated cardiac remodeling in mice

“…Transgenic mice with impaired ability to increase fatty acid oxidation capacity by deletion of the PPAR␣ gene respond to fasting-induced elevation of circulating fatty acid by accumulation of lipids in the myocardium (19). Compatible with a role of lipid accumulation in contractile dysfunction, PPAR␣-deficient mice exhibit reduced contractile reserve (16,24). Similarly, deletion of the PPAR␤/␦ gene results in lipotoxic cardiomyopathy (5).…”