Alteration of Bacterial Wilt Resistance in Tomato Plant by Microbiota Transplant

Abstract

Plant-associated microbiota plays an important role in plant disease resistance. Bacterial wilt resistance of tomato is a function of the quantitative trait of tomato plants; however, the mechanism underlying quantitative resistance is unexplored. In this study, we hypothesized that rhizosphere microbiota affects the resistance of tomato plants against soil-borne bacterial wilt caused by Ralstonia solanacearum. This hypothesis was tested using a tomato cultivar grown in a defined soil with various microbiota transplants. The bacterial wilt-resistant Hawaii 7996 tomato cultivar exhibited marked suppression and induction of disease severity after treatment with upland soil-derived and forest soil-derived microbiotas, respectively, whereas the transplants did not affect the disease severity in the susceptible tomato cultivar Moneymaker. The differential resistance of Hawaii 7996 to bacterial wilt was abolished by diluted or heat-killed microbiota transplantation. Microbial community analysis revealed the transplant-specific distinct community structure in the tomato rhizosphere and the significant enrichment of specific microbial operational taxonomic units (OTUs) in the rhizosphere of the upland soil microbiota-treated Hawaii 7996. These results suggest that the specific transplanted microbiota alters the bacterial wilt resistance in the resistant cultivar potentially through a priority effect.

Exploring Microbial Biosignatures in Mn-Deposits of Deep Biosphere: A Preliminary Cross-Disciplinary Approach to Investigate Geomicrobiological Interactions in a Cave in Central Italy

“…A specific 16S rRNA protocol has designed to amplify prokaryotes (bacteria and archaea) using paired-end 16S rRNA community sequencing on the Mi-Seq Illumina platform (Bio-Fab Research, Italy). The primers used in this protocol target the 16S rRNA V3 and V4 region (Mizrahi-Man et al, 2013;Choi et al, 2020). Illumina adapter overhang nucleotide sequences were added to the gene-specific sequences.…”

Morpho-Mineralogical and Bio-Geochemical Description of Cave Manganese Stromatolite-Like Patinas (Grotta del Cervo, Central Italy) and Hints on Their Paleohydrological-Driven Genesis

“…Mi-Seq Illumina platform, using primers that targeted the V3 and V4 regions of 16S rRNAi.e. Forward Primer 5′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTAC GGGNGGCWGCAG, Reverse Primer 5′ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACT ACHVGGGTATCTAATCC (Choi et al, 2020). A metagenomic workflow was carried out to classify microorganisms, using QIIME2 (Bolyen et al, 2019) and SILVA 132 database (https://www.arb-silva.de/); taxonomic assignments were checked through LPSN service (https://lpsn.dsmz.de).…”

Myxococcus xanthus R31 Suppresses Tomato Bacterial Wilt by Inhibiting the Pathogen Ralstonia solanacearum With Secreted Proteins

“…R. solanacearum can infect more than 200 species in 54 families of plants (Prior et al, 2016), including tomato, tobacco, potato, banana, pepper, etc., thereby posing a serious threat to food security (Zhang et al, 2020). TBW is a vascular disease that often breaks out under the conditions of high temperatures and high humidity (Choi et al, 2020). Pathogen infection can lead to substantial crop production losses, especially in tropical, subtropical, and other regions with warm temperature (Wang et al, 2018).…”