Allosteric Modulation of Estrogen Receptor Conformation by Different Estrogen Response Elements

Abstract

Estrogen-regulated gene expression is dependent on interaction of the estrogen receptor (ER) with the estrogen response element (ERE). We assessed the ability of the ER to activate transcription of reporter plasmids containing either the consensus vitellogenin A2 ERE or the imperfect pS2, vitellogenin B1, or oxytocin (OT) ERE. The A2 ERE was the most potent activator of transcription. The OT ERE was significantly more effective in activating transcription than either the pS2 or B1 ERE. In deoxyribonuclease I (DNase I) footprinting experiments, MCF-7 proteins protected A2 and OT EREs more effectively than the pS2 and B1 EREs. Limited protease digestion of the A2, pS2, B1, or OT ERE-bound receptor with V8 protease or proteinase K produced distinct cleavage products demonstrating that individual ERE sequences induce specific changes in ER conformation. Receptor interaction domains of glucocorticoid receptor interacting protein 1 and steroid receptor coactivator 1 bound effectively to the A2, pS2, B1, and OT ERE-bound receptor and significantly stabilized the receptor-DNA interaction. Similar levels of the full-length p160 protein amplified in breast cancer 1 were recruited from HeLa nuclear extracts by the A2, pS2, B1, and OT ERE-bound receptors. In contrast, significantly less transcriptional intermediary factor 2 was recruited by the B1 ERE-bound receptor than by the A2 ERE-bound receptor. These studies suggest that allosteric modulation of ER conformation by individual ERE sequences influences the recruitment of specific coactivator proteins and leads to differential expression of genes containing divergent ERE sequences.

Interaction of Estrogen Receptor α with 3-Methyladenine DNA Glycosylase Modulates Transcription and DNA Repair

“…These experiments combined with our GST-MPG pull-down studies indicate that ERE-containing DNA increases the interaction of ER␣ with MPG. We have previously demonstrated that DNA acts as an allosteric modulator of ER␣ conformation and thereby influences the interaction of the receptor with coregulatory proteins (5,25,27). Our current studies suggest that the interaction of the receptor with the ERE enhances the recruitment of MPG to estrogen-responsive genes.…”

“…Pull-down Assay-Pull-down assays were carried out by adsorbing 200 pmol of annealed biotinylated oligos containing the A2 ERE or a nonspecific DNA sequence to streptavidin-agarose beads as described (25). The immobilized DNA was incubated with 400 pmol of baculovirus-expressed, purified ER␣ in the presence of 1 M 17␤-estradiol (E 2 ) for 10 min followed by addition of 500 g of HeLa nuclear extract prepared as described (25).…”

“…The immobilized DNA was incubated with 400 pmol of baculovirus-expressed, purified ER␣ in the presence of 1 M 17␤-estradiol (E 2 ) for 10 min followed by addition of 500 g of HeLa nuclear extract prepared as described (25). Immobilized DNA was also incubated with HeLa nuclear extracts in the absence of ER␣ as a control for nonspecific binding.…”

“…Immobilized DNA was also incubated with HeLa nuclear extracts in the absence of ER␣ as a control for nonspecific binding. After 2 h at 4°C, the beads were washed as described (25) and the bound proteins were eluted in SDS sample buffer, separated by SDS-PAGE, and silver stained. A 35-kDa band, which was observed in the presence, but not in the absence of ER␣, was excised and analyzed by micro-liquid chromatography-electron spray ionization tandem mass spectrometry (MS) as previously reported (26).…”

Estrogen-occupied Estrogen Receptor Represses Cyclin G2 Gene Expression and Recruits a Repressor Complex at the Cyclin G2 Promoter

“…DNA Pulldown Assays-Pulldown assays were carried out as described (32) using biotinylated oligonucleotides containing the vitellogenin A2 ERE (33) or a nonspecific sequence (33) or the cyclin G2 promoter sequence (5Ј-/Bio/CGTCCCCCTCCTCGGCACCAGTC-CAGGCCGGTCGCG), a cyclin G2 promoter sequence with mutated half-ERE or a sequence containing only a half-ERE but no Sp1 binding sites (5Ј-/Bio/CTAGATTACTTCTCATGTTAGTTCTACTGACCA-CTAGATTACTTCTCATGTTAGCC), which were synthesized by Integrated DNA Technologies, Coralville, IA. Each annealed oligonucleotide (200 pmol) was adsorbed on to streptavidin-agarose beads (Pierce).…”