Allelic variation and differential expression at the 27-kilodalton zein locus in maize.

Das, O. Prem; Messing, Joachim

doi:10.1128/mcb.7.12.4490

Cited by 55 publications

(58 citation statements)

References 43 publications

(49 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Breeding haplotype combinations through improved inbreds could conceivably lead to the production of hybrids that perform better. We would expect that expression patterns between inbreds and hybrids would be additive, as in the case of 27-kDa ␥-zein, where reciprocal crosses between the S and Ra haplotypes seemed to follow a simple gene dosage effect (16,17). However, such ''dominance complementation'' fits the expression pattern only of the azs22.9-B73 gene in the z1C-1 locus.…”

Section: Molecular Basis Of Heterosis In Maizementioning

confidence: 97%

Gene expression of a gene family in maize based on noncollinear haplotypes

Song

Messing

2003

Proc. Natl. Acad. Sci. U.S.A.

244

215

View full text Add to dashboard Cite

Genomic regions of nearly every species diverged into different haplotypes, mostly based on point mutations, small deletions, and insertions that do not affect the collinearity of genes within a species. However, the same genomic interval containing the z1C gene cluster of two inbred lines of Zea mays significantly lost their gene collinearity and also differed in the regulation of each remaining gene set. Furthermore, when inbreds were reciprocally crossed, hybrids exhibited an unexpected shift of expression patterns so that ''overdominance'' instead of ''dominance complementation'' of allelic and nonallelic gene expression occurred. The same interval also differed in length (360 vs. 263 kb). Segmental rearrangements led to sequence changes, which were further enhanced by the insertion of different transposable elements. Changes in gene order affected not only z1C genes but also three unrelated genes. However, the orthologous interval between two subspecies of rice (not rice cultivars) was conserved in length and gene order, whereas changes between two maize inbreds were as drastic as changes between maize and sorghum. Given that chromosomes could conceivably consist of intervals of haplotypes that are highly diverged, one could envision endless breeding opportunities because of their linear arrangement along a chromosome and their expression potential in hybrid combinations (''binary'' systems). The implication of such a hypothesis for heterosis is discussed. z1C zein gene cluster ͉ heterosis ͉ genomic organization ͉ overdominance ͉ transposition C orn or Zea mays is one of the most important crops in the world.Although wheat and rice surpass it as a staple and in acreage, no crop rivals its total grain yield and the diversity of its uses as processed food, for animal feed and sweetener in soft drinks, and its industrial applications such as fuel and adhesives. The preference of corn over other grains or legumes for such applications is because of the unusual properties of hybrids. When distant inbred lines are crossed, the resulting hybrids exhibit an unusual vigor (heterosis) that results in higher yields per acre than the parental lines would produce themselves (1). The premium exercised for the breeding of steadily improved maize inbreds customized for different geographic areas has generated a huge enterprise worldwide, particularly in the United States, yet the underlying molecular mechanism for hybrid vigor is not well understood. To decide between two models explaining ''dominance complementation'' or ''overdominance'' of heterozygotes, it will therefore be necessary to compare not only the genomic architecture of genes within an interval of several hundred kilobases but also the expression of these genes of two parental inbreds and their reciprocal hybrids.The fact that some gene families are highly clustered within such lengthy intervals rather than spread over the entire genome is the springboard for our study. One such interval encodes the 22-kDa ␣-zein storage proteins. These proteins accumulate d...

show abstract

Section: Molecular Basis Of Heterosis In Maizementioning

confidence: 97%

Gene expression of a gene family in maize based on noncollinear haplotypes

Song

Messing

2003

Proc. Natl. Acad. Sci. U.S.A.

244

215

View full text Add to dashboard Cite

show abstract

“…A large number of zein genes encode proteins of discrete molecular sizes, which are divided into four classes according to similarities in the primary protein structures (13,19). Whereas the (x-class 22-and 19-kDa zeins are encoded by a large gene family of 25 to 50 members (6,16,43), the 3-class 15-kDa zein, y-class 16-and 27-kDa zeins, and 8-class 10-kDa zein are encoded by genes present in only a few copies (2,10,19,44). Expression of these different zein genes is regulated at both the transcriptional and the posttranscriptional levels (3,8,20).…”

mentioning

confidence: 99%

“…One million protoplasts isolated from the endosperm suspension cells were electroporated with 25 jig of plasmid DNA containing each chimeric CAT gene construct as previously described (39). For each electroporation, 10 ,ug of pFFGUS plasmid (38), containing the E. coli ,-glucuronidase (GUS) reporter gene placed under the control of the CaMV 35S promoter (with duplicated enhancer elements) and 3' control sequence, was coelectroporated to standardize the electroporation efficiency. As negative and positive controls for transient-expression experiments, f-CAT, a promoterless CAT gene equipped with the CaMV 35S 3' control sequence, and pFFCAT, the CAT gene placed under the control of the CaMV 35S promoter (with duplicated enhancer elements) and the 3' control sequence (39), respectively, were used.…”

mentioning

confidence: 99%

Identification of a transcriptional activator-binding element in the 27-kilodalton zein promoter, the -300 element.

et al. 1994

View full text Add to dashboard Cite

By utilizing a homologous transient-expression system, we have shown that a 58-bp sequence from the y-class 27-kDa zein promoter, spanning from -307 to -250 relative to the transcription start site, confers a high level of transcriptional activity on a truncated plant viral promoter. The transcriptional activity mediated by the 58-bp sequence is orientation independent, and it is further enhanced as a result of its multimerization. A similarly high level of transcriptional activity was also observed in protoplasts isolated from leaf tissue-derived maize suspension cells. In vitro binding and DNase I footprinting assays with nuclear proteins prepared from cultured endosperm cells revealed the sequence-specific binding of a nuclear factor(s) to a 16-nucleotide sequence present in the 58-bp region. The nuclear factor binding sequence includes the -300 element, a cis-acting element highly conserved among different zein genes and many other cereal storage protein genes. A 23-bp oligonucleotide sequence containing the nuclear factor binding site is sufficient for binding the nuclear factor in vitro. It also confers a high level of transcriptional activity in vivo, but in an orientation-dependent manner. Four nucleotide substitutions in the -300 element drastically reduced binding and transcriptional activation by the nuclear factor. The same nuclear factor is abundant in the developing kernel endosperm and binds to the -300 element region of the 27-kDa or the a-class zein promoter. These results suggest that the highly conserved -300 element is involved in the common regulatory mechanisms mediating the coordinated expression of the zein genes.

show abstract

“…The Glb1 gene was present as one copy in the genome (Kriz 1989) and the 27zn gene was present in most cases as one or two copies in the genome (Das and Messing 1987). Therefore, the native 27zn and Glb1 genes were desirable for endogenous gene Fig.…”

Section: Transgene Copy Number Of Transformation Eventsmentioning

confidence: 99%

“…The target genes in the present study were the GFP transgene (primers: forward CCTCGTGACCACCTTCACCTA; reverse ACCATGTGA TCGCGCTTCT) and the endogenous genes used for comparison were Glb1 present at one copy in the genome (Kriz 1989) (primers: forward CACTGTGGAACACGACAAAGTCTG: reverse CTCACCATGCTGTAGTGTCACTGTGAT) and the 27zn which is present at 1-2 copies in the genome (Das and Messing 1987) (primers: forward ATTGCACGTCAAGGGTATTGG; reverse TCTT GTGTTCTATGCCACCGA). PCR efficiencies were >90% using standard curves of a dilution series for the GFP transgene and endogenous Glb1 and 27zn genes by using the method of Bubner et al (2004).…”

Section: Evaluation Of Transgene Copy Numbermentioning

confidence: 99%

Green Fluorescent Protein as a Tissue Marker in Transgenic Maize Seed

et al. 2008

View full text Add to dashboard Cite

Seed tissues (endosperm, embryo, and pericarp) are often separated into tissue‐enriched fractions by wet‐ or dry‐milling methods for use in food, feed, and industrial products. Seed tissue markers that are sensitive and readily quantifiable would be useful to optimize fractionation processes. To meet this need for tissue markers, we set out to produce and characterize different transgenic maize lines, each containing green fluorescent protein (GFP) in either endosperm or embryo. We examined mRNA transcripts using expressed sequence tag (EST) profiles of several major seed proteins and selected several with strong seed tissue preferences. Stably transformed maize lines were produced, and visual observation of fluorescence confirmed the presence of GFP in the desired tissues. To establish the utility of this grain for evaluating the effectiveness or separation efficiencies of fractionation processes, transgenic kernels were hand‐dissected into pericarp, endosperm, and embryo fractions and the GFP concentration in each fraction was determined. The GFP distribution between fractions of each transgenic event was calculated from GFP concentration and mass balance, which enabled the determination of GFP yield based on the hand‐dissection fractionation data and the amount of tissue contamination in each fraction. Our transgenic lines exhibited strong tissue preference for either embryo or endosperm. These lines should be useful for assessing separation efficiencies in maize fractionation processes.

show abstract

Allelic variation and differential expression at the 27-kilodalton zein locus in maize.

Cited by 55 publications

References 43 publications

Gene expression of a gene family in maize based on noncollinear haplotypes

Gene expression of a gene family in maize based on noncollinear haplotypes

Identification of a transcriptional activator-binding element in the 27-kilodalton zein promoter, the -300 element.

Green Fluorescent Protein as a Tissue Marker in Transgenic Maize Seed

Contact Info

Product

Resources

About