Allele-specific binding of RNA-binding proteins reveals functional genetic variants in the RNA

Abstract

Allele-specific protein-RNA binding is an essential aspect that may reveal functional genetic variants influencing RNA processing and gene expression phenotypes. Recently, genome-wide detection of in vivo binding sites of RNA binding proteins (RBPs) is greatly facilitated by the enhanced UV crosslinking and immunoprecipitation (eCLIP) protocol. Hundreds of eCLIP-Seq data sets were generated from HepG2 and K562 cells during the ENCODE3 phase. These data afford a valuable opportunity to examine allele-specific binding (ASB) of RBPs. To this end, we developed a new computational algorithm, called BEAPR (Binding Estimation of Allele-specific Protein-RNA interaction). In identifying statistically significant ASB sites, BEAPR takes into account UV cross-linking induced sequence propensity and technical variations between replicated experiments. Using simulated data and actual eCLIP-Seq data, we show that BEAPR largely outperforms often-used methods Chi-Squared test and Fisher's Exact test. Importantly, BEAPR overcomes the inherent over-dispersion problem of the other methods. Complemented by experimental validations, we demonstrate that ASB events are significantly associated with genetic regulation of splicing and mRNA abundance, supporting the usage of this method to pinpoint functional genetic variants in post-transcriptional gene regulation. Many variants with ASB patterns of RBPs were found as genetic variants with cancer or other disease relevance. About 38% of ASB variants were in linkage disequilibrium with single nucleotide polymorphisms from genome-wide association studies. Overall, our results suggest that BEAPR is an effective method to reveal ASB patterns in eCLIP and can inform functional interpretation of diseaserelated genetic variants.

Genetic control of RNA editing in Neurodegenerative disease

“…Furthermore, to uncover the potential mechanisms for the associations between genetic variants and RNA editing events, we mainly explored it from the view of interfered RNA binding effects (Figure 3), due to the possibility of allele-specific binding and editing regulations of RNA binding proteins proposed in previous studies (14,81). Beside the main editing enzyme of ADAR, we also discovered multiple other factors involved in the regulations of A-to-I RNA editing, including the top RNA binding proteins such as EIF4A3, U2AF2, NOP58, FBL, NOP56, and DHX9.…”

Skipper analysis of RNA-protein interactions highlights depletion of genetic variation in translation factor binding sites

“…Indeed, mutation of RBP binding sites induce splicing changes in accordance with the corresponding RBP's distinct gene regulatory role. [35][36][37][38] To examine alternative splicing regulation at the level of individual RBPs, we overlapped 5′ and 3′ splice sites flanking alternative cassette exons with the expanded set of enriched windows called by Skipper. We stratified the alternative exons by whether an RBP of interest bound the alternative splice site window, the constitutive splice site window, or both and searched for stereotyped RBP binding patterns (Figure 4a).…”

Differential RNA editing between epithelial and mesenchymal tumors impacts mRNA abundance in immune response pathways

“…Next, we experimentally validated the regulation of mRNA abundance by six editing sites within three genes: RNF24, RHOA, and MRPS16. We used a minigene reporter with bi-directional promoters for mCherry and eYFP 48 and cloned edited and unedited versions of each editing site and its surrounding 3' UTR region into the 3' UTR of mCherry. Using expression of eYFP as an internal control, we compared mCherry expression between cells carrying the edited and unedited versions for each editing site.…”

“…Edited versions of 3' UTR inserts were generated using overlap-extension PCR (Supplementary table 3). Edited and unedited versions of 3' UTR regions were then cloned into the pTRE-BI-red/yellow vector via ClaI and SalI-HF enzyme sites 48 . To obtain a lentiviral vector expressing ILF3 shRNA, oligos containing the target sequence (GGTCTTCCTAGAGCGTATAAA, TRCN0000329788) were ordered from Integrated DNA Technologies (IDT) and cloned into pLKO.1 via EcoRI and AgeI enzyme sites.…”