Agroinfection as an alternative to insects for infecting plants with beet western yellows luteovirus.

202

144

Higher plants employ a homology-dependent RNA-degradation system known as posttranscriptional gene silencing (PTGS) as a defense against virus infection. Several plant viruses are known to encode proteins that can suppress PTGS. Here we show that P0 of beet western yellows virus (BWYV) displays strong silencing suppressor activity in a transient expression assay based upon its ability to inhibit PTGS of green fluorescent protein (GFP) when expressed in agro-infiltrated leaves of Nicotiana benthamiana containing a GFP transgene. PTGS suppressor activity was also observed for the P0s of two other poleroviruses, cucurbit aphid-borne yellows virus and potato leafroll virus. P0 is encoded by the 5-proximal gene in BWYV RNA but does not accumulate to detectable levels when expressed from the genome-length RNA during infection. The low accumulation of P0 and the resulting low PTGS suppressor activity are in part a consequence of the suboptimal translation initiation context of the P0 start codon in viral RNA, although other factors, probably related to the viral replication process, also play a role. A mutation to optimize the P0 translation initiation efficiency in BWYV RNA was not stable during virus multiplication in planta. Instead, the P0 initiation codon in the progeny was frequently replaced by a less efficient initiation codon such as ACG, GTG, or ATA, indicating that there is selection against overexpression of P0 from the viral genome.Most if not all plants possess a defense mechanism against virus infection known as posttranscriptional gene silencing (PTGS; see reference 44 for a recent review). PTGS is a homology-dependent RNA degradation system to recognize and degrade viral RNA (and any homologous transgene mRNA) in the cytoplasm. Mechanistically similar phenomena exist in animals and fungi (reviewed in references 4, 13, and 35). The mechanism by which a virus infection triggers PTGS in plants is not fully understood, but double-stranded RNA is a strong inducer of PTGS (43) and such a form is produced during replication of an RNA virus. Production of small RNAs of ϳ21 to 23 nucleotides, called small interfering RNAs (siRNAs), corresponding to both the plus and minus strands of the target RNA is associated with PTGS (12,13,45). In plants, gene silencing at one site can trigger PTGS in distant tissues and across a graft union (29, 39a). The mobile signal, which must consist at least in part of homologous RNA, is thought to move from cell to cell through plasmodesmata and systemically via the vasculature. Some plant viruses have been shown to encode proteins which can counteract PTGS (8,22,39,40,42). These silencing suppressor proteins may act at different steps in the PTGS pathway. Thus, (i) the potyvirus helper component-proteinase (HCPro) interferes with initiation and maintenance of silencing at a step coincident with or upstream of siRNA production (1,7,16,23,24), (ii) the 2b protein of cucumber mosaic virus (CMV) prevents initiation of PTGS in new growth by inhibiting the long-range PTGS signaling acti...

Section: Resultsmentioning

confidence: 99%

“…Full-length BWYV cDNA in pBW 0 (20) was used as template for PCR amplification of the BWYV P0 ORF using appropriate specific primers. A nonviral EcoRV restriction site was added to the 5Ј extremity of each primer.…”

Section: Methodsmentioning

confidence: 99%

P0 of Beet Western Yellows Virus Is a Suppressor of Posttranscriptional Gene Silencing

Pfeffer

Dunoyer

Heim

et al. 2002

202

144

“…The DNA fragment containing the 35S promoter and 5Ј region of the BYV cDNA was PCR amplified by using the primers 5Ј-TAGAGCTCAACATGGTGGAGCAC and 5Ј-CATCTAGAAGTT CACCCGGAG and was cloned into minibinary vector pCB301 digested with SacI and XbaI (53) to yield a pCB-35S-5BYV-NOS plasmid. A primer complementary to the 3Ј end of the BYV sequence followed by a self-cleaving ribozyme (27) was synthesized (5Ј-TACCCGGGCCGTTTCGTCCTCACGGACTCATC AGAAGACATGTGAATCATGTCTTGACGGCCCTTATTTTTTCTTC) and used in combination with the upstream primer, 5Ј-ATTGGCAAACGCGGGA TCCCGT, to amplify the 3Ј region of the BYV-green fluorescent protein (GFP) cDNA and to add ribozyme sequence. This PCR product was digested with BamHI and XmaI and was cloned into pCB-35S-5BYV-NOS plasmid to produce pCB-35S-5Ј3ЈBYV-Rib-NOS.…”

Section: Methodsmentioning

confidence: 99%

Interaction between Long-Distance Transport Factor and Hsp70-Related Movement Protein of Beet Yellows Virus

Prokhnevsky

Peremyslov

Napuli

et al. 2002

109

110

Systemic spread of viruses in plants involves local movement from cell to cell and long-distance transport through the vascular system. The cell-to-cell movement of the Beet yellows virus (BYV) is mediated by a movement protein that is an Hsp70 homolog (Hsp70h). This protein is required for the assembly of movementcompetent virions that incorporate Hsp70h. By using the yeast two-hybrid system, in vitro coimmunoprecipitation, and in planta coexpression approaches, we show here that the Hsp70h interacts with a 20-kDa BYV protein (p20). We further demonstrate that p20 is associated with the virions presumably via binding to Hsp70h. Genetic and immunochemical analyses indicate that p20 is dispensable for assembly and cell-to-cell movement of BYV but is required for the long-distance transport of virus through the phloem. These results reveal a novel activity for the Hsp70h that provides a molecular link between the local and systemic spread of a plant virus by docking a long-distance transport factor to virions.

“…were made by replacing the SpeI-SalI fragment (extends from nt 1350 to 32 nt downstream of the insert 3Ј terminus) of pBinBW 0 by the SpeI-SalI fragment from the corresponding mutant transcription vector. The resulting plasmids were introduced into Agrobacterium tumefaciens LBA4404 for agroinfection (2,18). Infected plants were identified by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) with a rabbit polyclonal antiserum raised against virus (4).…”

Section: Mutants Of Bwyvmentioning

confidence: 99%

Effects of Point Mutations in the Readthrough Domain of the Beet Western Yellows Virus Minor Capsid Protein on Virus Accumulation In Planta and on Transmission by Aphids

Brault

Mutterer

Scheidecker

et al. 2000

Point mutations were introduced into or near five conserved sequence motifs of the readthrough domain of the beet western yellows virus minor capsid protein P74. The mutant virus was tested for its ability to accumulate efficiently in agroinfected plants and to be transmitted by its aphid vector, Myzus persicae. The stability of the mutants in the agroinfected and aphid-infected plants was followed by sequence analysis of the progeny virus. Only the mutation Y201D was found to strongly inhibit virus accumulation in planta following agroinfection, but high accumulation levels were restored by reversion or pseudoreversion at this site. Four of the five mutants were poorly aphid transmissible, but in three cases successful transmission was restored by pseudoreversion or second-site mutations. The same second-site mutations in the nonconserved motif PVT(32-34) were shown to compensate for two distinct primary mutations (R24A and E59A/D60A), one on each side of the PVT sequence. In the latter case, a second-site mutation in the PVT motif restored the ability of the virus to move from the hemocoel through the accessory salivary gland following microinjection of mutant virus into the aphid hemocoel but did not permit virus movement across the epithelium separating the intestine from the hemocoel. Successful movement of the mutant virus across both barriers was accompanied by conversion of A59 to E or T, indicating that distinct features of the readthrough domain in this region operate at different stages of the transmission process.