Advances in Nematode Identification: A Journey from Fundamentals to Evolutionary Aspects

Abstract

Nematodes are non-segmented roundworms evenly distributed with various habitats ranging to approximately every ecological extremity. These are the least studied organisms despite being the most diversified group. Nematodes are the most critical equilibrium-maintaining factors, having implications on the yield and health of plants as well as well-being of animals. However, taxonomic knowledge about nematodes is scarce. As a result of the lack of precise taxonomic features, nematode taxonomy remains uncertain. Morphology-based identification has proved inefficacious in identifying and exploring the diversity of nematodes, as there are insufficient morphological variations. Different molecular and new evolving methodologies have been employed to augment morphology-based approaches and bypass these difficulties with varying effectiveness. These identification techniques vary from molecular-based targeting DNA or protein-based targeting amino acid sequences to methods for image processing. High-throughput approaches such as next-generation sequencing have also been added to this league. These alternative approaches have helped to classify nematodes and enhanced the base for increased diversity and phylogeny of nematodes, thus helping to formulate increasingly more nematode bases for use as model organisms to study different hot topics about human well-being. Here, we discuss all the methods of nematode identification as an essential shift from classical morphometric studies to the most important modern-day and molecular approaches for their identification. Classification varies from DNA/protein-based methods to the use of new emerging methods. However, the priority of the method relies on the quality, quantity, and availability of nematode resources and down-streaming applications. This paper reviews all currently offered methods for the detection of nematodes and known/unknown and cryptic or sibling species, emphasizing modern-day methods and budding molecular techniques.

Meloidogyne enterolobii risk to agriculture, its present status and future prospective for management

“…This method has been designed and employed to distinguish the RKN species ( Bhat et al., 2022 ). M. enterolobii was identified using a sequence characterized amplified region (SCAR) primer pair, such as MK7F/MK7R (GATCAGAGGCGGGCGCATTGCGA/CGAACTCGCTCGAACTCGAC) ( Tigano et al., 2010 ).…”

Recent Advances and Potential Future Applications of MALDI-TOF Mass Spectrometry for Identification of Helminths

“…The utilization of MALDI-TOF MS for nematode identification has been reported by recent studies of either pathogen-associated proteins or the pathogen itself at different developmental stages (adults, larvae, or eggs) [ 23 , 24 ]. Bredtmann and colleagues [ 25 ] showed the possible differentiation of adult worms of two closely related cyathostomin species, i.e., Cylicostephanus longibursatus and Cylicostephanus minutus .…”

Molecular World Today and Tomorrow: Recent Trends in Biological Sciences

“…Molecular dynamics and approaches have evolved into various quantitative tools that allow researchers from multiple disciplines to design different studies. The molecular-based techniques can be comprehensive and systematic, as they allow for the identification and resolution of genetic differences, molecular docking, and the construction of prediction models of ecological niches and taxonomic ranks [ 1 , 2 ]. The investigation of genomics, proteomics, and phylogenetic techniques requires the utilization of a novel class of DNA elements such as microsatellites from mitochondria and chloroplast and retrotransposons, resulting in genetic variations using molecular data [ 3 ].…”