Advanced colorectal polyps with the molecular and morphological features of serrated polyps and adenomas: concept of a ‘fusion’ pathway to colorectal cancer

Abstract

Advanced colorectal polyps with the molecular and morphological features of serrated polyps and adenomas: concept of a 'fusion' pathway to colorectal cancer Aim: To establish and explain the pattern of molecular signatures across colorectal polyps. Methods and results: Thirty-two sessile serrated adenomas (SSA), 10 mixed polyps (MP), 15 traditional serrated adenomas (SA), 49 hyperplastic polyps (HP) and 84 adenomas were assessed for mutation of KRAS and BRAF and aberrant expression of p53. The findings were correlated with loss of expression of O-6-methylguanine DNA methyltransferase (MGMT). KRAS mutation occurred more frequently (26.5%) than BRAF mutation (4.8%) in adenomas (P < 0.001) and particularly in adenomas with villous architecture (50%). Loss of expression of MGMT correlated with KRAS mutation in small tubular adenomas (P < 0.04). BRAF mutation was frequent in HPs (67%) and SSAs (81%), while KRAS mutation was infrequent (4% and 3%, respectively). Of MPs and SAs, 72% had either BRAF or KRAS mutation. Aberrant expression of p53 was uncommon overall, but occurred more frequently in MPs and SAs (12%) than adenomas (1%) (P < 0.04) and there was concordant loss of expression of MGMT. Conclusions: Molecular alterations that are characteristic of the serrated pathway and adenoma-carcinoma sequence can co-occur in a minority of advanced colorectal polyps that then show morphological features of both pathways. These lesions account for only 2% of colorectal polyps, but may be relatively aggressive.

Colorectal carcinomas with KRAS mutation are associated with distinctive morphological and molecular features

“…40 These canonical pathways are largely linear in nature, and are likely to serve as the foundation of colorectal carcinoma development in the majority of instances. In 2006, Jass et al 41 proposed a 'fusion pathway', which combined elements from the canonical pathways. It was suggested that other mutational alterations, such as the inactivation of MGMT, may combine with KRAS and TP53 mutations to produce malignant transformation.…”

Clinicopathologic and molecular features of sporadic early-onset colorectal adenocarcinoma: an adenocarcinoma with frequent signet ring cell differentiation, rectal and sigmoid involvement, and adverse morphologic features

“…21,22 Briefly, real-time PCR was performed using allelespecific primers designed to selectively amplify the wild-type (T1796) and mutant (A1796) BRAF alleles. The primer sequences were as follows: V, 5 0 -GTGATTTTGGTC TAGC TACtGT; E, 5 0 -CGCGG CCGGCCGCGGCGGTGATTTTGGTCTA GCTACcGA; and AS, 5 0 -TAGCCTCAATTCTTACCAT CCAC.…”

Distinct WNT/β-catenin signaling activation in the serrated neoplasia pathway and the adenoma-carcinoma sequence of the colorectum

“…4,[6][7][8][9][10][11][12][13] In contrast, KRAS mutations have shown to be rare in SSA/Ps (0-8%), but more common in conventional tubular adenomas (5-37%). 4,6,10,11,13 In our study, BRAF mutations were frequent (82%), whereas KRAS mutation was not detected in SSA/ Ps, with clearly contrasting results for tubular adenomas (BRAF mutation, 0%, KRAS mutation, 26%). Similar trends were found in SSA/Ps with high-grade dysplasia vs tubular adenomas with high-grade dysplasia and SSA/Ps with submucosal carcinoma vs tubular adenomas with submucosal carcinoma.…”

“…shown associations of SSA/P and those with dysplasia or carcinoma with methylation or loss of protein expression for DNA repair genes, ie, MLH1, 1,4,6-9 a CpG island methylator phenotype, 3,4,6,8 BRAF mutations, 3,4,[6][7][8][9][10][11][12][13][14] and a lack of genetic alterations in CTNNB1 (the gene coding for b-catenin protein). 14 This pathway is thought to be distinct from the conventional adenoma-carcinoma pathway, where adenomas progress to invasive colorectal carcinomas through the influence of a series of genetic alterations including adenomatous polyposis coli (APC) and KRAS mutations.…”

“…14 This pathway is thought to be distinct from the conventional adenoma-carcinoma pathway, where adenomas progress to invasive colorectal carcinomas through the influence of a series of genetic alterations including adenomatous polyposis coli (APC) and KRAS mutations. 4,6,10,11,15,16 The WNT signaling pathway has a vital role in embryogenesis, 17 and its deregulation is also implicated in colorectal carcinogenesis. 18 b-Catenin in the resting state is degraded by proteasomes resulting from its phosphorylation by a multiprotein complex containing APC, AXIN, and glycogen synthase kinase 3b (GSK3b).…”