Adult-Onset Hepatocyte GH Resistance Promotes NASH in Male Mice, Without Severe Systemic Metabolic Dysfunction

Abstract

Nonalcoholic fatty liver disease (NAFLD), which includes nonalcoholic steatohepatitis (NASH), is associated with reduced GH input/signaling, and GH therapy is effective in the reduction/resolution of NAFLD/NASH in selected patient populations. Our laboratory has focused on isolating the direct vs indirect effects of GH in preventing NAFLD/NASH. We reported that chow-fed, adult-onset, hepatocyte-specific, GH receptor knockdown (aHepGHRkd) mice rapidly (within 7 days) develop steatosis associated with increased hepatic de novo lipogenesis (DNL), independent of changes in systemic metabolic function. In this study, we report that 6 months after induction of aHepGHRkd early signs of NASH develop, which include hepatocyte ballooning, inflammation, signs of mild fibrosis, and elevated plasma alanine aminotransferase. These changes occur in the presence of enhanced systemic lipid utilization, without evidence of white adipose tissue lipolysis, indicating that the liver injury that develops after aHepGHRkd is due to hepatocyte-specific loss of GH signaling and not due to secondary defects in systemic metabolic function. Specifically, enhanced hepatic DNL is sustained with age in aHepGHRkd mice, associated with increased hepatic markers of lipid uptake/re-esterification. Because hepatic DNL is a hallmark of NAFLD/NASH, these studies suggest that enhancing hepatocyte GH signaling could represent an effective therapeutic target to reduce DNL and treat NASH.

Hepatocyte-Specific Loss of PPARγ Protects Mice From NASH and Increases the Therapeutic Effects of Rosiglitazone in the Liver

“…RNA was extracted using Trizol Reagent (Life Technologies, Carlsbad, CA) and used to perform RNAseq or quantitative polymerase chain reaction as previously described. 54 , 55 , 56 Sequences of the primers used for quantitative polymerase chain reaction are described in Supplementary Data . Libraries preparation, sequencing, and bioinformatics analysis of RNAseq were performed by Novogen (Novogen, Inc, Sacramento CA).…”

Loss of Hepatocyte-Specific PPARγ Expression Ameliorates Early Events of Steatohepatitis in Mice Fed the Methionine and Choline-Deficient Diet

“…Two weeks after AAV injections, half of the mice in each group were switched to a methionine-and choline-deficient (MCD) diet (Cat # A02082002BR, Research Diets, New Brunswick, NJ), and the other half were fed a nutrientmatched methionine-and choline-supplemented (MSD) diet (Cat # A02082003BY, Research Diets). The mice were fed MSD and MCD diets for three weeks, and then, food was withdrawn at 0700 h and mice were injected ip at 1100 h with 0.5 μg 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (BOD-IPY)-C16 (Life Technologies)/g body weight as previously reported [28]. Blood was collected from the lateral tail vein at t = 0, 1, and 3 hours after BODIPY-C16 injections to determine the levels of BODIPY-C16 in plasma.…”

“…Peptidylprolyl isomerase (Ppia), β-actin (Actb), and hypoxanthineguanine phosphoribosyltransferase (Hprt) were used as housekeeping genes to calculate a normalization factor, as previously reported [29]. qPCR primer sequences of Ppia, Actb, Hprt, Pparg, Cd36, tumor necrosis factor alpha (Tnfa), transforming growth factor beta 1 (Tgfb1), alpha smooth muscle actin (aSma), and collagen 1a1 (Col1a1) were published previously [28]. Primer sequences of F4/80 (NM_010130.4) Se: AGTACGATGTGGGGCTTTTG, As: TCTGTGGTGTCAGTGCAGGT, 164 bp; metalloproteinase…”

Adipocyte JAK2 mediates spontaneous metabolic liver disease and hepatocellular carcinoma

“…Cordoba-Chacon et al recently reported that knockdown of hepatocyte Ghr in adult mice (aHep-GHRkd) promotes fatty liver and NASH via increased DNL without severe alterations in systemic metabolism or adipose tissue lipolysis (47). This led them to conclude that liver disease from loss of hepatocyte GH signaling occurs via liver-autonomous means.…”

“…However, given that circulating NEFA levels are the net result of release and uptake, and that loss of hepatic GH signaling induces Cd36 (which increases NEFA uptake), it is difficult to make any conclusions on the state of lipolysis (39). To directly address this, Cordoba-Chacon et al (47) used adipose explant cultures to demonstrate that aHepGHRkd had normal basal and stimulated rates of lipolysis. This is also consistent with our previously published results showing that GH does not affect basal lipolysis but instead specifically interferes with the ability of insulin to suppress lipolysis (19).…”