Adoptive transfer of CD4+Foxp3+ regulatory T cells to C57BL/6J mice during acute infection with Toxoplasma gondii down modulates the exacerbated Th1 immune response

Olguín, Jonadab E.; Fernández, Jacquelina; Salinas-Jazmín, Nohemí; Juárez, Imelda; Rodrı́guez-Sosa, Miriam; Campuzano, Jaime; Castellanos, Carlos; Saavedra, Rafael

doi:10.1016/j.micinf.2015.04.002

Cited by 24 publications

(21 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…It was also demonstrated that TReg expansion with JES6-1A12-containing IL2C can overcome the competition for bioavailable IL-2 by regulatory and effector T cells, leading to reduced immunopathology and morbidity during acute Type II T. gondii ME49 infection [40]. These studies are in line with other reports showing a collapse of TReg cells during acute T. gondii infection due to IL-2 starvation and an overall protective role of TRegs in acute T. gondiimediated immunopathogenesis [75][76][77][78]. In contrast to JES6-1A12-containing IL2C, S4B6containing IL2C has been shown to boost NK cell and memory CD8 + T cell numbers in mice and to enhance their cytolytic capacity against viral infections, malaria [79] and cancer cells [71,[80][81][82].…”

Section: Interventionssupporting

confidence: 81%

Treatment of mice with IL2-complex enhances inflammasome-driven IFN-γ production and prevents lethal toxoplasmosis

Kupz

Pai

Giacomin

et al. 2019

Preprint

View full text Add to dashboard Cite

24Toxoplasmic encephalitis is an AIDS-defining condition in HIV + individuals. The decline of 25 IFN-γ-producing CD4 + T cells in AIDS is a major contributing factor in reactivation of 26 quiescent Toxoplasma gondii to an actively replicating stage of infection. Hence, it is important 27 to identify CD4-independent mechanisms to control acute T. gondii infection. Here we have 28 investigated the targeted expansion and regulation of IFN-γ production by CD8 + T cells, DN T 29 cells and NK cells in response to T. gondii infection using IL-2 complex (IL2C) pre-treatment 30 in an acute in vivo mouse model. Our results show that expansion of CD8 + T cells, DN T cells 31 and NK cell by S4B6 IL2C treatment increases survival rates of mice infected with T. gondii 32 and this increased survival is dependent on both IL-12-and IL-18-driven IFN-γ production. 33 Processing and secretion of IFN-γ-inducing, bioactive IL-18 is dependent on the sensing of 34 active parasite invasion by multiple redundant inflammasome sensors in multiple hematopoietic 35 cell types but independent from T. gondii-derived dense granule (GRA) proteins. Our results 36 provide evidence for a protective role of IL2C-mediated expansion of CD8 + T cells, DN T cells 37 and NK cells in murine toxoplasmosis and may represent a promising adjunct therapy for acute 38 toxoplasmosis. 39 40 41 3 Author Summary 42A third of the world's population is chronically infected with the parasite Toxoplasma gondii. 43 In most cases the infection is asymptomatic, but in individuals suffering from AIDS, 44 reactivation of brain and muscle cysts containing T. gondii is a significant cause of death. The 45 gradual decline of CD4 T cells, the hallmark of AIDS, is believed to be a major contributing 46 factor in reactivation of T. gondii infection and the development of acute disease. In this study, 47 we show that targeted expansion of non-CD4 immune cell subsets can prevent severe disease 48 and premature death via increased availability of interferon gamma-producing immune cells. 49 We also demonstrate that the upstream signaling molecule interleukin-18 is required for the 50 protective immune response by non-CD4 cells and show that the sensing of active parasite 51 invasion by danger recognition molecules is crucial. Our findings reveal that targeted cell 52 expansion may be a promising therapy in toxoplasmosis and suggests that the development of 53 novel intervention strategies targeting danger recognition pathways may be useful against 54 toxoplasmosis, particularly in the context of AIDS. 55 57 [1]. It is estimated that one-third of the world's population is infected with T. gondii. In most 58 individuals, infection is asymptomatic and leads to chronic, life-long persistence of T. gondii-59 containing cysts, primarily in brain and muscle tissue [2]. Active disease, also known as 60 toxoplasmosis, usually occurs after reactivation of encysted parasites, and is often associated 61 with immunosuppression. If untreated, toxoplasmosis may be fatal. Addi...

show abstract

Section: Interventionssupporting

confidence: 81%

Treatment of mice with IL2-complex enhances inflammasome-driven IFN-γ production and prevents lethal toxoplasmosis

Kupz

Pai

Giacomin

et al. 2019

Preprint

View full text Add to dashboard Cite

show abstract

“…The RNA was purified using a PureLink™ RNA Mini Kit (ThermoFisher) following the manufacturer's instructions. The cDNA was amplified using SuperScript™ First-Strand Synthesis System for RT-PCR (Invitrogen) for IL-7, TGF-β and IL-2-specific primers as described 34 . The gene expression was normalized to the expression of a reference gene (GAPDH) as described 34 .…”

Section: Methodsmentioning

confidence: 99%

“…The cDNA was amplified using SuperScript™ First-Strand Synthesis System for RT-PCR (Invitrogen) for IL-7, TGF-β and IL-2-specific primers as described 34 . The gene expression was normalized to the expression of a reference gene (GAPDH) as described 34 . The primers used to amplify the genes were as follows: for IL-2, IL-2-F (AGCAGCACCTGGAGCAGCTG) and IL-2-R (GTCCACCACAGTTGCTGACT); for IL-7, IL-7-F (GCCTGTCACATCATCTGAGTGCC) and IL-7-R (CAGGAGGCATCCAGGAACTTCTG); for TGF-β, TGF-β-F (GCCCTTCCTGCTCCTCAT) and TGF-β-R (TTGGCATGGTAGCCCTTG); and for GAPDH, GAPDH-F (CTCATGACCACAGTCCATGC) and GAPDH-R (CACATTGGGGGTAGGAACAC) (Sigma).…”

Section: Methodsmentioning

confidence: 99%

Early and Partial Reduction in CD4⁺Foxp3⁺ Regulatory T Cells during Colitis-Associated Colon Cancer Induces CD4⁺ and CD8⁺ T Cell Activation Inhibiting Tumorigenesis

et al. 2018

Self Cite

View full text Add to dashboard Cite

Colorectal cancer (CRC) is the second most commonly diagnosed cancer in women and the third in men in North America and Europe. CRC is associated with inflammatory responses in which intestinal pathology is caused by different cell populations including a T cell dysregulation that concludes in an imbalance between activated T (Tact) and regulatory T (Treg) cells. Treg cells are CD4+Foxp3+ cells that actively suppress pathological and physiological immune responses, contributing to the maintenance of immune homeostasis. A tumor-promoting function for Treg cells has been suggested in CRC, but the kinetics of Treg cells during CRC development are poorly known. Therefore, using a mouse model of colitis-associated colon cancer (CAC) induced by azoxymethane and dextran sodium sulfate, we observed the dynamic and differential kinetics of Treg cells in blood, spleen and mesenteric lymph nodes (MLNs) as CAC progresses, highlighting a significant reduction in Treg cells in blood and spleen during early CAC development, whereas increasing percentages of Treg cells were detected in late stages in MLNs. Interestingly, when Treg cells were decreased, Tact cells were increased and vice versa. Treg cells from late stages of CAC displayed an activated phenotype by expressing PD1, CD127 and Tim-3, suggesting an increased suppressive capacity. Suppression assays showed that T-CD4+ and T-CD8+ cells were suppressed more efficiently by MLN Treg cells from CAC animals. Finally, an antibody-mediated reduction in Treg cells during early CAC development resulted in a better prognostic value, because animals showed a reduction in tumor progression associated with an increased percentage of activated CD4+CD25+Foxp3- and CD8+CD25+ T cells in MLNs, suggesting that Treg cells suppress T cell activation at early steps during CAC development.

show abstract

“…Conversely, Tregs have a critical role in maintaining immune homeostasis, controlling autoimmune diseases, and inhibiting excessive immune responses against microbes and allergens. It has previously been demonstrated that Tregs are able to downregulate Th1 function, reverse pre-established autoimmune pathology and may be used in the treatment of autoimmune diseases (28,29). Unfortunately, the adoptive transfer of Tregs may convert them Th1-like Treg or Th17 in the local microenvironment of autoimmune disease and loss of the function of Tregs (30,31).…”

Section: Discussionmentioning

confidence: 99%

Cell penetrable-mouse forkhead box P3 suppresses type 1 T helper cell-mediated immunity in a murine model of delayed-type hypersensitivity

Liu

Wang

et al. 2017

Experimental and Therapeutic Medicine

View full text Add to dashboard Cite

Forkhead box P3 (FOXP3), which is a transcription factor, has a primary role in the development and function of regulatory T cells, and thus contributes to homeostasis of the immune system. A previous study generated a cell-permeable fusion protein of mouse FOXP3 conjugated to a protein transduction domain (PTD-mFOXP3) that successfully blocked differentiation of type 17 T helper cells in vitro and alleviated experimental arthritis in mice. In the present study, the role of PTD-mFOXP3 in type 1 T helper (Th1) cell-mediated immunity was investigated and the possible mechanisms for its effects were explored. Under Th1 polarization conditions, cluster of differentiation 4+ T cells were treated with PTD-mFOXP3 and analyzed by flow cytometry in vitro, which revealed that PTD-mFOXP3 blocked Th1 differentiation in vitro. Mice models of delayed type hypersensitivity (DTH) reactions were generated by subcutaneous sensitization and challenge with ovalbumin (OVA) to the ears of mice. PTD-mFOXP3, which was administered via local subcutaneous injection, significantly reduced DTH-induced inflammation, including ear swelling (ear swelling, P<0.001; pinnae weight, P<0.05 or P<0.01 with 0.25 and 1.25 mg/kg PTD-mFOXP3, respectively), infiltration of T cells, and expression of interferon-γ at local inflammatory sites (mRNA level P<0.05) compared with the DTH group. The results of the present study demonstrated that PTD-mFOXP3 may attenuate DTH reactions by suppressing the infiltration and activity of Th1 cells.

show abstract

Adoptive transfer of CD4+Foxp3+ regulatory T cells to C57BL/6J mice during acute infection with Toxoplasma gondii down modulates the exacerbated Th1 immune response

Cited by 24 publications

References 36 publications

Treatment of mice with IL2-complex enhances inflammasome-driven IFN-γ production and prevents lethal toxoplasmosis

Treatment of mice with IL2-complex enhances inflammasome-driven IFN-γ production and prevents lethal toxoplasmosis

Early and Partial Reduction in CD4⁺Foxp3⁺ Regulatory T Cells during Colitis-Associated Colon Cancer Induces CD4⁺ and CD8⁺ T Cell Activation Inhibiting Tumorigenesis

Cell penetrable-mouse forkhead box P3 suppresses type 1 T helper cell-mediated immunity in a murine model of delayed-type hypersensitivity

Contact Info

Product

Resources

About

Adoptive transfer of CD4+Foxp3+ regulatory T cells to C57BL/6J mice during acute infection with Toxoplasma gondii down modulates the exacerbated Th1 immune response

Cited by 24 publications

References 36 publications

Treatment of mice with IL2-complex enhances inflammasome-driven IFN-γ production and prevents lethal toxoplasmosis

Treatment of mice with IL2-complex enhances inflammasome-driven IFN-γ production and prevents lethal toxoplasmosis

Early and Partial Reduction in CD4+Foxp3+ Regulatory T Cells during Colitis-Associated Colon Cancer Induces CD4+ and CD8+ T Cell Activation Inhibiting Tumorigenesis

Cell penetrable-mouse forkhead box P3 suppresses type 1 T helper cell-mediated immunity in a murine model of delayed-type hypersensitivity

Contact Info

Product

Resources

About

Early and Partial Reduction in CD4⁺Foxp3⁺ Regulatory T Cells during Colitis-Associated Colon Cancer Induces CD4⁺ and CD8⁺ T Cell Activation Inhibiting Tumorigenesis