Adhesion, Biofilm Formation, and Genomic Features of Campylobacter jejuni Bf, an Atypical Strain Able to Grow under Aerobic Conditions

Abstract

Campylobacter jejuni is the leading cause of bacterial enteritis in Europe. Human campylobacteriosis cases are frequently associated to the consumption of contaminated poultry meat. To survive under environmental conditions encountered along the food chain, i.e., from poultry digestive tract its natural reservoir to the consumer’s plate, this pathogen has developed adaptation mechanisms. Among those, biofilm lifestyle has been suggested as a strategy to survive in the food environment and under atmospheric conditions. Recently, the clinical isolate C. jejuni Bf has been shown to survive and grow under aerobic conditions, a property that may help this strain to better survive along the food chain. The aim of this study was to evaluate the adhesion capacity of C. jejuni Bf and its ability to develop a biofilm. C. jejuni Bf can adhere to abiotic surfaces and to human epithelial cells, and can develop biofilm under both microaerobiosis and aerobiosis. These two conditions have no influence on this strain, unlike results obtained with the reference strain C. jejuni 81-176, which harbors only planktonic cells under aerobic conditions. Compared to 81-176, the biofilm of C. jejuni Bf is more homogenous and cell motility at the bottom of biofilm was not modified whatever the atmosphere used. C. jejuni Bf whole genome sequence did not reveal any gene unique to this strain, suggesting that its unusual property does not result from acquisition of new genetic material. Nevertheless some genetic particularities seem to be shared only between Bf and few others strains. Among the main features of C. jejuni Bf genome we noticed (i) a complete type VI secretion system important in pathogenicity and environmental adaptation; (ii) a mutation in the oorD gene involved in oxygen metabolism; and (iii) the presence of an uncommon insertion of a 72 amino acid coding sequence upstream from dnaK, which is involved in stress resistance. Therefore, the atypical behavior of this strain under aerobic atmosphere may result from the combination of insertions and mutations. In addition, the comparison of mRNA transcript levels of several genes targeted through genome analysis suggests the modification of regulatory processes in this strain.

Virulence Traits of Inpatient Campylobacter jejuni Isolates, and a Transcriptomic Approach to Identify Potential Genes Maintaining Intracellular Survival

“…An arsenal of genes (jlpA, capA, cjaA, flpA, fbpA, cadF, cj0268, cj0090, cj0091, cj1136, cj0286c, and cj0379c) have previously been confirmed or suggested to play a role in C. jejuni adhesion [14][15][16][17]19,20,68]. The large differences between the adhesion potentials of ECMPs and INT 407 cells was in harmony with recent findings focusing on the adhesion potentials of C. jejuni isolates from different origins to biotic and abiotic surfaces [95,96]. The diverse protein composition expressed on the surface of individual isolates could strongly influence adhesion potential and thereby affect the outcome of infections [58].…”

Characterisation of Aerotolerant Forms of a Robust Chicken Colonizing Campylobacter coli

“…Similar experiments with aerotolerant C. coli OR12 could provide valuable insight as to whether improved aerotolerance in vitro translates to superior survival on product, which would be of public health significance. This may be further considered in the context of the recently described aerobic C. jejuni strain Bf, which was found to be able to adhere to human epithelial cells and form biofilms under aerobic conditions (Bronnec et al, 2016). …”

“…Orthologs of rrpA and rrpB , encoding MarR-like transcription factors implicated in oxidative stress resistance, could not be identified in the genome sequences of C. coli OR12 or RM1875 or 15-537360 (Gundogdu et al, 2015). Bronnec et al (2016) identified a complete type VI secretion system in C. jejuni Bf and suggested that it may contribute to the aerotolerant phenotype. The C. coli OR12 genome contains a complete T6SS, although C. coli RM2228, which did not demonstrate aerotolerance, also possesses a full T6SS (Bleumink-Pluym et al, 2013).…”

High prevalence of Campylobacter jejuni CC21 and CC257 clonal complexes in children with gastroenteritis in Iran: A global analysis

“…One of the isolates that neither had the selected capsular serotypes nor the LOS locus classes was considered as a reference gene. The PCR reaction mixture consisted of 100 ng to1 mg of cDNA (for dnaK and 16S rRNA genes), 1 mM of each primers (Table 3) [15] 16SrRNA AAGGGCCATGATGACTTGACG AGCGCAACCCACGTATTTAG 107 [15] Multilocus Sequence Typing (mlst)…”

“…[15] and 12.5 mL of SYBR Green I Master Mix. Cycling conditions included an initial denaturing step of 10 min at 95 °C followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C.…”