Adenoviral Transduction Efficiency of Ovarian Cancer Cells Can Be Limited by Loss of Integrin β₃Subunit Expression and Increased by Reconstitution of Integrin α_vβ₃

Abstract

Recombinant adenoviruses expressing a therapeutic gene are currently used in clinical studies for treatment of advanced ovarian cancer. We therefore tested whether the expression level of primary (CAR) and secondary adenovirus receptors (integrins) was predictive of the efficacy of adenoviral gene transfer in ovarian cancer cells. Adenoviral transduction efficiency (ATE) was determined with an E1-deleted adenovirus type 5 expressing beta-galactosidase under a CMV promoter (AdGal). ATE was studied in relationship to the expression level of both CAR (coxsackie and adenovirus receptor) and integrins. A representative sample of 25 permanent human cell lines established from advanced ovarian cancer in our laboratory and the OV-2774 cell line were tested. Overall, ATE increased with increasing titers of AdGal. At a given titer of 50 infectious units per cell, transduction efficiency varied from 6 to 94% among the individual cell lines. All cell lines expressed CAR and integrin alpha(v)beta(5), but no relation between ATE and expression level of CAR or alpha(v)beta(5) integrin was observed. In contrast, cell lines with poor ATE, despite expressing high levels of CAR, lacked expression of integrins alpha(v)beta(3) and alpha(5)beta(1). Reconstitution of alpha(v)beta(3) integrin by reexpressing the beta(3) subunit significantly enhanced ATE of ovarian cancer cells. In ovarian cancer, neither integrins nor CAR alone appear to be potentially useful predictive markers for ATE by serotype 5 adenovirus in clinical gene therapy. A minimum level of CAR necessary for binding of adenoviruses was observed in all tested ovarian cancer cell lines. Loss of alpha(v)beta(3) integrin is frequently associated with advanced stages of ovarian cancer and can significantly reduce ATE.

CAR is a cell–cell adhesion protein in human cancer cells and is expressionally modulated by dexamethasone, TNFα, and TGFβ

“…The human ovarian carcinoma cell lines OV-MZ-30, OV-MZ-31, OV-MZ-33 and OV-UL-2 have been described previously. 17 Cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum, 100 mg streptomycin per ml, 100 U penicillin G per ml and 2 mM glutamine at 371C in a humidified atmosphere with 5% CO 2.…”

“…17 In brief, a 195 bp PCR product from the CAR cDNA was amplified using primer pair GCAGGAGCCATTATAGGAACTTTG/ GGACCCCAGGGATGAATGAT and b-actin primers (Stratagene) for co-amplification of a 661 bp product from the b-actin cDNA as an internal standard. PCR conditions for amplification were 3 min at 941C, followed by 27 cycles of 94, 55 and 721C for 1 min each and an extension of 10 min at 721C.…”

“…12 Several studies tried to establish correlations between CAR or integrin expression levels and adenoviral gene transfer efficiency. [13][14][15][16][17] Despite diverging results, it was generally concluded that either loss of CAR expression or that of RGD-binding integrins was a main obstacle for efficient adenoviral gene transfer into cancer cells in cell culture. [13][14][15][16][17] For ovarian cancer cells, we noticed that even cell lines with a high level of CAR expression can be resistant against adenoviral infection due to loss of integrin avb3 expression by transcriptional silencing of the integrin b3 subunit.…”

“…[13][14][15][16][17] Despite diverging results, it was generally concluded that either loss of CAR expression or that of RGD-binding integrins was a main obstacle for efficient adenoviral gene transfer into cancer cells in cell culture. [13][14][15][16][17] For ovarian cancer cells, we noticed that even cell lines with a high level of CAR expression can be resistant against adenoviral infection due to loss of integrin avb3 expression by transcriptional silencing of the integrin b3 subunit. 17 Integrin subunit expression can be regulated by several fibrogenic and pro-inflammatory cytokines such as TGFb 18,19 or TNFa.…”

“…[13][14][15][16][17] For ovarian cancer cells, we noticed that even cell lines with a high level of CAR expression can be resistant against adenoviral infection due to loss of integrin avb3 expression by transcriptional silencing of the integrin b3 subunit. 17 Integrin subunit expression can be regulated by several fibrogenic and pro-inflammatory cytokines such as TGFb 18,19 or TNFa. 20 Both TGFb and TNFa can be found at high concentrations in human cancer tissues.…”