AddTag, a two-step approach with supporting software package that facilitates CRISPR/Cas-mediated precision genome editing

Abstract

CRISPR/Cas-induced genome editing is a powerful tool for genetic engineering, however targeting constraints limit which loci are editable with this method. Since the length of a DNA sequence impacts the likelihood it overlaps a unique target site, precision editing of small genomic features with CRISPR/Cas remains an obstacle. We introduce a two-step genome editing strategy that virtually eliminates CRISPR/Cas targeting constraints and facilitates precision genome editing of elements as short as a single base-pair at virtually any locus in any organism that supports CRISPR/Cas-induced genome editing. Our two-step approach first replaces the locus of interest with an “AddTag” sequence, which is subsequently replaced with any engineered sequence, and thus circumvents the need for direct overlap with a unique CRISPR/Cas target site. In this study, we demonstrate the feasibility of our approach by editing transcription factor binding sites within Candida albicans that could not be targeted directly using the traditional gene editing approach. We also demonstrate the utility of the AddTag approach for combinatorial genome editing and gene complementation analysis, and we present a software package that automates the design of AddTag editing.

A Markerless CRISPR-Mediated System for Genome Editing in Candida auris Reveals a Conserved Role for Cas5 in the Caspofungin Response

“…1B ) created a unique “landing pad” site for subsequent genome editing, we tested the ability of this system to complement (i.e., add back) the deleted CAS5 gene at its native locus. Similar landing pads, also called “AddTags,” have been previously utilized in C. albicans to reintegrate deleted genes at their native loci ( 24 , 28 ). Briefly, we generated a new gRNA cassette to target our landing pad using the HYG selectable marker version of the C. auris LEUpOUT system.…”

Triazine-Based Small Molecules: A Potential New Class of Compounds in the Antifungal Toolbox

“…Homozygous null mutant C. albicans strains were constructed via CRISPR-Cas9 genome editing methods [ 25 , 26 ] using strain SN250 as the parental strain. Oligonucleotides and mutant strain genotypes are listed in Table S1 .…”

“…Oligonucleotides and mutant strain genotypes are listed in Table S1 . For each gene deletion, the native open reading frame was replaced with an exogenous CRISPR-Cas9 target sequence, or “AddTag”, as previously described [ 26 ]. Custom guide-RNA sequences were designed to target Cas9 cutting within the coding sequence of the gene to be deleted ( Table S1 ) and introduced into pADH139 via PCR stitching as previously described [ 25 ].…”

“…Custom guide-RNA sequences were designed to target Cas9 cutting within the coding sequence of the gene to be deleted ( Table S1 ) and introduced into pADH139 via PCR stitching as previously described [ 25 ]. Synthetic double-stranded donor DNA fragments containing AddTag sequences flanked by 50 bp homology arms that match the sequences immediately upstream and downstream of PHB1 and PHB2 were generated by primer extension as previously described [ 26 ]. For PHB12 deletion, a PCR assembly protocol was used to generate donor DNA fragments containing the AddTag sequence flanked by ~200 bp homology arms that match the sequences upstream and downstream of PHB12 as previously described [ 27 ].…”

Broad sensitivity ofCandida aurisstrains to quinolones and mechanisms of resistance

“…The repair template was created by amplifying genomic DNA and amplicons were subsequently stitched together with an additional round of PCR cycling to create full-length repair template integrating the desired mutation or deletion. When constructing a gene deletion strain, a unique 23bp ADDTAG (CGAGACGAGTGCTCGACATGAGG), which includes a 20 bp gRNA recognition sequence and PAM, was inserted at the location of the gene for any subsequent downstream edits at this locus (95, 96). Synonymous and non-synonymous mutations were introduced using the PCR stitching method and the mutations are denoted by lowercase letters in the oligo sequences described in File S4.…”